Strain Name:
C57BL/6J-MtgxR5869Btlr
Stock Number:
044077-MU
Citation ID:
RRID:MMRRC_044077-MU
Other Names:
R5869 (G1)
Major Collection:

Gene Information

Ptprf
Name: protein tyrosine phosphatase, receptor type, F
Synonyms: RPTP-LAR, LAR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Wdr82
Name: WD repeat domain containing 82
Synonyms: 9430077D24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 77305
Homologene: 42951
Clcnka
Name: chloride channel, voltage-sensitive Ka
Synonyms: CLC-K1, Clcnk1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 12733
Homologene: 65
Zfp523
Name: zinc finger protein 523
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 224656
Homologene: 2569
Kif20a
Name: kinesin family member 20A
Synonyms: Rabkinesin-6, Rab6kifl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 19348
VEGA: 18
HGNC: HGNC:9787
Homologene: 38093
Mier3
Name: MIER family member 3
Synonyms: D130064H19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 218613
Homologene: 18196
Exo1
Name: exonuclease 1
Synonyms: 5730442G03Rik, Msa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 26909
HGNC: HGNC:3511
Homologene: 31352
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, Helic1, B630009I04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 77987
VEGA: 10
Homologene: 4973
Cstf3
Name: cleavage stimulation factor, 3' pre-RNA, subunit 3
Synonyms: 4732468G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 228410
HGNC: HGNC:2485
Homologene: 1014
Aspscr1
Name: alveolar soft part sarcoma chromosome region, candidate 1 (human)
Synonyms: 1190006K01Rik, ASPCR1, ASPC, RCC17, TUG, ASPL
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 68938
Homologene: 41550
Ddx55
Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Synonyms: 2810021H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 67848
Homologene: 12196
Coro1c
Name: coronin, actin binding protein 1C
Synonyms: coronin 3, CRN2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 23790
HGNC: HGNC:2254
Homologene: 56537
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: Pcp1, InsP3R type I, P400, Itpr-1, IP3R1, Ip3r, wblo, Pcp-1, opt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Lpin2
Name: lipin 2
Synonyms: 2610511G02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 64898
Homologene: 8769
Pias1
Name: protein inhibitor of activated STAT 1
Synonyms: 2900068C24Rik, GBP, Ddxbp1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 56469
VEGA: 9
HGNC: HGNC:2752
Homologene: 22953
Rnf17
Name: ring finger protein 17
Synonyms: MMIP-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 30054
VEGA: 14
Homologene: 23727
Dcdc2a
Name: doublecortin domain containing 2a
Synonyms: RU2, Dcdc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 195208
Homologene: 9483
Nlrp3
Name: NLR family, pyrin domain containing 3
Synonyms: Cias1, Pypaf1, NALP3, cryopyrin, Mmig1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 216799
Homologene: 3600
Nup88
Name: nucleoporin 88
Synonyms: Nup84, Prei2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 19069
HGNC: HGNC:8067
Homologene: 1901
Fam135a
Name: family with sequence similarity 135, member A
Synonyms: 4921533L14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 68187
Homologene: 32665
Cnot3
Name: CCR4-NOT transcription complex, subunit 3
Synonyms: A930039N10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 232791
HGNC: HGNC:7879
Homologene: 133900
Ccdc174
Name: coiled-coil domain containing 174
Synonyms: C130022K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 232236
Homologene: 9523
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 269700
Homologene: 28297
Tnfrsf19
Name: tumor necrosis factor receptor superfamily, member 19
Synonyms: TAJ, Troy, TRADE, TAJ-ALPHA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 29820
VEGA: 14
Homologene: 8481
Zfp808
Name: zinc finger protein 808
Synonyms: Gm7036
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 630579
Homologene: 134631
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 70799
VEGA: 18
Homologene: 73526
Adarb1
Name: adenosine deaminase, RNA-specific, B1
Synonyms: RED1, 1700057H01Rik, ADAR2, D10Bwg0447e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 110532
HGNC: HGNC:226
Homologene: 8280
Pitx3
Name: paired-like homeodomain transcription factor 3
Synonyms: Ptx3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 18742
HGNC: HGNC:9006
Homologene: 3689
Ttn
Name: titin
Synonyms: D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, mdm, 1100001C23Rik, shru, connectin, L56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 22138
Homologene: 130650
Itga9
Name: integrin alpha 9
Synonyms: 2610002H11Rik, 6720458D17Rik, D9Ertd428e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 104099
HGNC: HGNC:6145
Homologene: 1664
Sdk2
Name: sidekick cell adhesion molecule 2
Synonyms: 4632412F08Rik, 5330435L01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 237979
Homologene: 10406
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: SM1, smMHC, SM2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: EGFL2, flamingo, mfmi1, Adgrc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Ptprh
Name: protein tyrosine phosphatase, receptor type, H
Synonyms: SAP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 545902
HGNC: HGNC:9672
Homologene: 37693
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Slc4a11
Name: solute carrier family 4, sodium bicarbonate transporter-like, member 11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 269356
Homologene: 12931
Mmp12
Name: matrix metallopeptidase 12
Synonyms: Mmel, macrophage elastase, MMP12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 17381
HGNC: HGNC:7158
Homologene: 20547
Ttc21a
Name: tetratricopeptide repeat domain 21A
Synonyms: 4921538N17Rik, Thm2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 74052
Homologene: 14728
Tmem229a
Name: transmembrane protein 229A
Synonyms: 6332401O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 319832
Homologene: 85312
Mroh3
Name: maestro heat-like repeat family member 3
Synonyms: 2310006M14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 76422
Igsf9b
Name: immunoglobulin superfamily, member 9B
Synonyms: LOC235086
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 235086
Homologene: 19472
Kcnb1
Name: potassium voltage gated channel, Shab-related subfamily, member 1
Synonyms: Kcr1-1, Shab, Kv2.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 16500
HGNC: HGNC:6231
Homologene: 37988
Spg20
Name: spastic paraplegia 20, spartin (Troyer syndrome) homolog (human)
Synonyms: TAHCCP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 229285
Rnf130
Name: ring finger protein 130
Synonyms: 2510042A13Rik, G1RP, G1RZFP
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 59044
Homologene: 41267
Car5a
Name: carbonic anhydrase 5a, mitochondrial
Synonyms: Car5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 12352
HGNC: HGNC:1377
Homologene: 68200
Slc5a5
Name: solute carrier family 5 (sodium iodide symporter), member 5
Synonyms: NIS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 114479
Homologene: 37311
Tnfrsf14
Name: tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)
Synonyms: Atar, Hvem, HveA
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 230979
Homologene: 2833
Arsk
Name: arylsulfatase K
Synonyms: 2810429K17Rik, 4833414G15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 77041
Homologene: 12670
Asz1
Name: ankyrin repeat, SAM and basic leucine zipper domain containing 1
Synonyms: ORF3, 4933400N19Rik, Gasz
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 74068
HGNC: HGNC:1350
Homologene: 11374
Uap1
Name: UDP-N-acetylglucosamine pyrophosphorylase 1
Synonyms: SPAG2, ESTM38, AgX, AGX1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 107652
Homologene: 2342
Krt1
Name: keratin 1
Synonyms: Krt-2.1, Krt2-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Gm4799
Name: predicted gene 4799
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 216185
VEGA: 10
Tmem30c
Name: transmembrane protein 30C
Synonyms: 4933409A18Rik, 4933401B01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
Alteration at locus: Chemically Induced
NCBI: 71027
Homologene: 78138
Prlhr
Name: prolactin releasing hormone receptor
Synonyms: GR3, Gpr10, PrRPR, LOC226278
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 226278
VEGA: 19
HGNC: HGNC:4464
Homologene: 3134
Pick1
Name: protein interacting with C kinase 1
Synonyms: Prkcabp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 18693
HGNC: HGNC:9394
Homologene: 7470
Plpp3
Name: phospholipid phosphatase 3
Synonyms: Lpp3, D4Bwg1535e, 1110003O22Rik, D4Bwg0538e, PRG-2, Ppap2b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 67916
HGNC: HGNC:9229
Homologene: 15410
Slc25a10
Name: solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10
Synonyms: Dic
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 27376
Homologene: 6519
Calm5
Name: calmodulin 5
Synonyms: Scarf2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 494124
Ighv1-76
Name: immunoglobulin heavy variable 1-76
Synonyms: Gm16813
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 100775174
Nat8f6
Name: N-acetyltransferase 8 (GCN5-related) family member 6
Synonyms: Gm11128
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 100504710
Homologene: 76450
Fignl2
Name: fidgetin-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 668225
VEGA: 15
Homologene: 28523
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 24,029,430 bp
  • T to A, chromosome 1 at 136,186,123 bp
  • T to A, chromosome 1 at 170,151,138 bp
  • T to C, chromosome 1 at 175,901,283 bp
  • A to C, chromosome 2 at 41,004,603 bp
  • G to A, chromosome 2 at 76,750,209 bp
  • A to G, chromosome 2 at 104,659,240 bp
  • A to C, chromosome 2 at 130,684,459 bp
  • A to G, chromosome 2 at 167,188,071 bp
  • A to T, chromosome 3 at 55,135,510 bp
  • G to A, chromosome 3 at 108,413,909 bp
  • T to A, chromosome 4 at 105,194,962 bp
  • A to C, chromosome 4 at 118,210,382 bp
  • A to G, chromosome 4 at 141,394,965 bp
  • C to A, chromosome 4 at 154,926,598 bp
  • A to G, chromosome 5 at 113,850,846 bp
  • T to C, chromosome 5 at 121,343,225 bp
  • A to G, chromosome 5 at 124,568,682 bp
  • T to C, chromosome 6 at 18,074,940 bp
  • T to C, chromosome 6 at 24,954,687 bp
  • A to C, chromosome 6 at 85,808,523 bp
  • T to A, chromosome 6 at 91,885,418 bp
  • T to C, chromosome 6 at 108,473,529 bp
  • A to T, chromosome 7 at 3,644,930 bp
  • T to C, chromosome 7 at 4,601,940 bp
  • C to A, chromosome 8 at 70,892,330 bp
  • G to A, chromosome 8 at 121,916,380 bp
  • GTAATAATAATAATAATAAT to GTAATAATAATAATAAT, chromosome 9 at 7,348,446 bp
  • C to A, chromosome 9 at 27,323,235 bp
  • A to T, chromosome 9 at 62,912,766 bp
  • A to G, chromosome 9 at 106,185,304 bp
  • A to G, chromosome 9 at 118,663,889 bp
  • A to G, chromosome 9 at 119,958,792 bp
  • C to T, chromosome 10 at 50,842,183 bp
  • T to C, chromosome 10 at 77,325,616 bp
  • A to T, chromosome 10 at 82,954,449 bp
  • A to G, chromosome 11 at 50,085,815 bp
  • G to A, chromosome 11 at 59,548,134 bp
  • T to C, chromosome 11 at 70,969,671 bp
  • A to G, chromosome 11 at 113,851,882 bp
  • C to T, chromosome 11 at 120,498,117 bp
  • T to C, chromosome 11 at 120,688,920 bp
  • T to C, chromosome 12 at 115,848,038 bp
  • T to A, chromosome 13 at 3,854,321 bp
  • C to T, chromosome 13 at 25,107,730 bp
  • T to A, chromosome 13 at 62,171,255 bp
  • T to C, chromosome 13 at 76,091,784 bp
  • T to A, chromosome 13 at 111,714,850 bp
  • A to C, chromosome 14 at 56,505,988 bp
  • C to T, chromosome 14 at 60,971,178 bp
  • A to G, chromosome 15 at 79,248,895 bp
  • T to C, chromosome 15 at 101,053,280 bp
  • A to T, chromosome 15 at 101,850,131 bp
  • A to G, chromosome 16 at 14,230,800 bp
  • A to G, chromosome 16 at 57,266,562 bp
  • T to C, chromosome 17 at 28,194,993 bp
  • A to G, chromosome 17 at 71,232,276 bp
  • G to A, chromosome 18 at 34,632,415 bp
  • A to G, chromosome 18 at 67,815,864 bp
  • A to T, chromosome 19 at 46,137,296 bp
  • C to A, chromosome 19 at 60,467,621 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5869 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
044077-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.