Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5869Btlr/Mmmh
Stock Number:
044077-MU
Citation ID:
RRID:MMRRC_044077-MU
Other Names:
R5869 (G1)
Major Collection:

Strain Information

Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Wdr82
Name: WD repeat domain containing 82
Synonyms: 9430077D24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77305
Homologene: 42951
Clcnka
Name: chloride channel, voltage-sensitive Ka
Synonyms: CLC-K1, Clcnk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12733
Homologene: 65
Zfp523
Name: zinc finger protein 523
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224656
Homologene: 2569
Kif20a
Name: kinesin family member 20A
Synonyms: Rabkinesin-6, Rab6kifl
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19348
VEGA: 18
HGNC: HGNC:9787
Homologene: 38093
Mier3
Name: MIER family member 3
Synonyms: D130064H19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218613
Homologene: 18196
Exo1
Name: exonuclease 1
Synonyms: Msa, 5730442G03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26909
HGNC: HGNC:3511
Homologene: 31352
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 24,029,430 bp
  • T to A, chromosome 1 at 136,186,123 bp
  • T to A, chromosome 1 at 170,151,138 bp
  • T to C, chromosome 1 at 175,901,283 bp
  • A to C, chromosome 2 at 41,004,603 bp
  • G to A, chromosome 2 at 76,750,209 bp
  • A to G, chromosome 2 at 104,659,240 bp
  • A to C, chromosome 2 at 130,684,459 bp
  • A to G, chromosome 2 at 167,188,071 bp
  • A to T, chromosome 3 at 55,135,510 bp
  • G to A, chromosome 3 at 108,413,909 bp
  • T to A, chromosome 4 at 105,194,962 bp
  • A to C, chromosome 4 at 118,210,382 bp
  • A to G, chromosome 4 at 141,394,965 bp
  • C to A, chromosome 4 at 154,926,598 bp
  • A to G, chromosome 5 at 113,850,846 bp
  • T to C, chromosome 5 at 121,343,225 bp
  • A to G, chromosome 5 at 124,568,682 bp
  • T to C, chromosome 6 at 18,074,940 bp
  • T to C, chromosome 6 at 24,954,687 bp
  • A to C, chromosome 6 at 85,808,523 bp
  • T to A, chromosome 6 at 91,885,418 bp
  • T to C, chromosome 6 at 108,473,529 bp
  • A to T, chromosome 7 at 3,644,930 bp
  • T to C, chromosome 7 at 4,601,940 bp
  • C to A, chromosome 8 at 70,892,330 bp
  • G to A, chromosome 8 at 121,916,380 bp
  • GTAATAATAATAATAATAAT to GTAATAATAATAATAAT, chromosome 9 at 7,348,446 bp
  • C to A, chromosome 9 at 27,323,235 bp
  • A to T, chromosome 9 at 62,912,766 bp
  • A to G, chromosome 9 at 106,185,304 bp
  • A to G, chromosome 9 at 118,663,889 bp
  • A to G, chromosome 9 at 119,958,792 bp
  • C to T, chromosome 10 at 50,842,183 bp
  • T to C, chromosome 10 at 77,325,616 bp
  • A to T, chromosome 10 at 82,954,449 bp
  • A to G, chromosome 11 at 50,085,815 bp
  • G to A, chromosome 11 at 59,548,134 bp
  • T to C, chromosome 11 at 70,969,671 bp
  • A to G, chromosome 11 at 113,851,882 bp
  • C to T, chromosome 11 at 120,498,117 bp
  • T to C, chromosome 11 at 120,688,920 bp
  • T to C, chromosome 12 at 115,848,038 bp
  • T to A, chromosome 13 at 3,854,321 bp
  • C to T, chromosome 13 at 25,107,730 bp
  • T to A, chromosome 13 at 62,171,255 bp
  • T to C, chromosome 13 at 76,091,784 bp
  • T to A, chromosome 13 at 111,714,850 bp
  • A to C, chromosome 14 at 56,505,988 bp
  • C to T, chromosome 14 at 60,971,178 bp
  • A to G, chromosome 15 at 79,248,895 bp
  • T to C, chromosome 15 at 101,053,280 bp
  • A to T, chromosome 15 at 101,850,131 bp
  • A to G, chromosome 16 at 14,230,800 bp
  • A to G, chromosome 16 at 57,266,562 bp
  • T to C, chromosome 17 at 28,194,993 bp
  • A to G, chromosome 17 at 71,232,276 bp
  • G to A, chromosome 18 at 34,632,415 bp
  • A to G, chromosome 18 at 67,815,864 bp
  • A to T, chromosome 19 at 46,137,296 bp
  • C to A, chromosome 19 at 60,467,621 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5869 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044077-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.