Strain Name:
Stock Number:
Citation ID:
Other Names:
R5973 (G1)
Major Collection:

Gene Information

Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20185
Homologene: 38166
Name: methyl-CpG binding domain protein 5
Synonyms: 9430004D19Rik, C030040A15Rik, OTTMUSG00000012483
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 109241
Homologene: 81861
Name: spinster homolog 1
Synonyms: 2210013K02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 73658
Homologene: 41530
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 13518
Homologene: 136716
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 75560
Homologene: 38779
Name: KAT8 regulatory NSL complex subunit 2
Synonyms: 2310037I24Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 69612
VEGA: 15
Homologene: 32367
Name: ASH2 like histone lysine methyltransferase complex subunit
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 23808
Homologene: 3436
Name: protein kinase C, iota
Synonyms: Pkcl, Pkci, 2310021H13Rik, Prkcl, aPKClambda, PKClambda
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 18759
Homologene: 37667
Name: SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms: 1200016B10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66875
Homologene: 32355
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, RA-GEF-2, Pdzgef2, C030018K18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 192786
Homologene: 22968
Name: mutS homolog 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 17685
Homologene: 210
Name: signal-induced proliferation-associated 1 like 3
Synonyms: 2610511M17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 74206
Homologene: 77938
Name: ASXL transcriptional regulator 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 228790
Homologene: 9098
Name: paraoxonase 1
Synonyms: Pon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 18979
Homologene: 68058
Name: predicted gene 14124
Synonyms: EG640962, Gm10749
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 100216455
Homologene: 134546
Name: VPS39 HOPS complex subunit
Synonyms: A230065P22Rik, Vam6P, Vam6, mVam6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 269338
Homologene: 41025
Name: NFKB inhibitor interacting Ras-like protein 2
Synonyms: 4930527H08Rik, KBRAS2, 2410003M04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 71966
Homologene: 9738
Name: AFG3-like AAA ATPase 2
Synonyms: 2310036I02Rik, par, Emv66
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 69597
VEGA: 18
Homologene: 4947
Name: ClpB caseinolytic peptidase B
Synonyms: Skd3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 20480
Homologene: 32067
Name: anaphase promoting complex subunit 7
Synonyms: prediabetic NOD sera-reactive autoantigen, APC7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56317
Homologene: 10512
Name: plexin A4
Synonyms: Plxa4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 243743
Homologene: 77587
Name: Ly1 antibody reactive clone
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 17089
Homologene: 41200
Name: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 11957
Homologene: 1272
Name: fucosyltransferase 8
Synonyms: alpha (1,6) fucosyltransferase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 53618
VEGA: 12
Homologene: 9650
Name: hemicentin 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 665700
Homologene: 90772
Name: mastermind like transcriptional coactivator 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 270118
Homologene: 134147
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 545370
Homologene: 23741
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b1279Clo, b2b598Clo, b2b1289Clo, b2b1727Clo, b2b1203Clo, Dnahc11, avc4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13411
Homologene: 2801
Name: acetyl-Coenzyme A carboxylase beta
Synonyms: Accb, Acc2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 100705
Homologene: 74382
Name: olfactory receptor 901
Synonyms: GA_x6K02T2PVTD-32123032-32123967, MOR162-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 258028
Homologene: 79399
Name: neuropeptide Y receptor Y4
Synonyms: NYYR-D, Y4, Ppyr1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 19065
VEGA: 14
Homologene: 38119
Name: regulator of calcineurin 3
Synonyms: Csp3, Dscr1l2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 53902
Homologene: 8388
Name: poly(A)-specific ribonuclease (PARN)-like domain containing 1
Synonyms: LOC240023
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240023
VEGA: 17
Homologene: 15054
Name: calsequestrin 1
Synonyms: CSQ-1, CSQ1, CSQ, sCSQ
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 12372
Homologene: 20329
Name: microrchidia 2B
Synonyms: 4932411A10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 240069
Homologene: 18615
Name: predicted gene 15130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Name: monooxygenase, DBH-like 2
Synonyms: Dbhl1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 194357
Homologene: 77226
Name: solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2
Synonyms: sodium/dicarboxylate co-transporter, mNaDC-1, Nadc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20500
Homologene: 2965
Name: sulfotransferase family 6B, member 2
Synonyms: LOC330440, Gm766
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330440
Homologene: 66632
Name: inosine monophosphate dehydrogenase 1
Synonyms: B930086D20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 23917
Homologene: 68096
Name: inhibin beta-B
Synonyms: activin beta-B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16324
Homologene: 1654
Name: villin 1
Synonyms: Villin
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 22349
Homologene: 5169
Name: WD repeat domain 90
Synonyms: 3230401M21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 106618
Homologene: 27066
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 213452
Homologene: 19711
Name: keratin 2
Synonyms: Krt2-2, Krt2e, Krt2-17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 16681
Name: XIAP associated factor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 327959
Homologene: 49488
Name: transcobalamin 2
Synonyms: Tcn-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 21452
Homologene: 303
Name: N-ethylmaleimide sensitive fusion protein attachment protein gamma
Synonyms: SNARE, 2400003O04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 108123
Homologene: 2838
Name: protein tyrosine phosphatase, receptor type, U
Synonyms: Ptprl, RPTPlambda
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 19273
Homologene: 4168
Name: olfactory receptor 1333
Synonyms: GA_x6K02T2QD9B-18703033-18703986, MOR259-6, MOR259-11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 258265
Homologene: 134082
Name: B cell leukemia/lymphoma 2 related protein A1c
Synonyms: A1-c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 12046
Name: protein kinase D1
Synonyms: Pkcm, PKD1, Prkcm
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 18760
VEGA: 12
Homologene: 55680
Name: cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)
Synonyms: Achr-2, Acrb, AChR beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 11443
Homologene: 594
Name: beaded filament structural protein 2, phakinin
Synonyms: CP49
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 107993
Homologene: 20791
Name: transient receptor potential cation channel, subfamily C, member 4
Synonyms: CCE1, Trp4, STRPC4, Trrp4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 22066
Homologene: 22955
Name: tryptophanyl tRNA synthetase 2 (mitochondrial)
Synonyms: 9430020O07Rik, TrpRS
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 70560
Homologene: 5673
Name: ceramide synthase 6
Synonyms: T1L, similar to TRH1, 4732462C07Rik, CerS6, Lass6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241447
Homologene: 72228
Name: UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
Synonyms: 5730445F03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 227620
Homologene: 71313
Name: predicted gene 5724
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 435927
Name: Fas apoptotic inhibitory molecule 2
Synonyms: NMP25, 2900002L20Rik, lifeguard, Lfg, Tmbim2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 72393
VEGA: 15
Homologene: 8192
Name: HCLS1 associated X-1
Synonyms: mHAX-1s, HAX-1, Silg111, Hs1bp1, HS1-associated protein X-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 23897
Homologene: 4463
Name: SH3 domain and tetratricopeptide repeats 2
Synonyms: D430044G18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225608
VEGA: 18
Homologene: 11596
Name: ARP1 actin-related protein 1B, centractin beta
Synonyms: Arp1b, 2310066K23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226977
Homologene: 101541
Name: carcinoembryonic antigen-related cell adhesion molecule 16
Synonyms: LOC330483
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 330483
Homologene: 19857
Name: mab-21-like 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 17116
Homologene: 36183
Name: fucose-1-phosphate guanylyltransferase
Synonyms: 1700016E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 75540
Homologene: 2847
Name: olfactory receptor 589
Synonyms: GA_x6K02T2PBJ9-5871256-5870303, MOR32-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259054
Homologene: 133046
Name: protocadherin gamma subfamily B, 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 93700
Homologene: 49571
Name: dual specificity phosphatase 2
Synonyms: PAC1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 13537
Homologene: 3255
Name: PRAME like 51
Synonyms: Gm10436
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 100039315
VEGA: 12
Homologene: 103830
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Name: LYR motif containing 9
Synonyms: 1810012P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 66274
Homologene: 47720
Name: predicted gene 17087
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 100416032
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,156,857 bp
  • A to G, chromosome 1 at 36,702,081 bp
  • T to G, chromosome 1 at 74,416,033 bp
  • A to T, chromosome 1 at 119,418,076 bp
  • A to G, chromosome 1 at 132,434,411 bp
  • A to G, chromosome 1 at 150,563,817 bp
  • A to G, chromosome 1 at 151,402,949 bp
  • A to G, chromosome 1 at 172,219,501 bp
  • A to T, chromosome 2 at 25,364,630 bp
  • G to A, chromosome 2 at 31,420,323 bp
  • A to G, chromosome 2 at 49,272,389 bp
  • T to A, chromosome 2 at 69,068,625 bp
  • A to G, chromosome 2 at 111,135,369 bp
  • A to T, chromosome 2 at 120,328,705 bp
  • A to T, chromosome 2 at 127,337,288 bp
  • A to G, chromosome 2 at 150,267,935 bp
  • T to C, chromosome 2 at 153,402,011 bp
  • G to T, chromosome 3 at 31,038,456 bp
  • A to G, chromosome 3 at 54,315,842 bp
  • A to G, chromosome 3 at 55,783,112 bp
  • C to T, chromosome 3 at 83,922,246 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • A to G, chromosome 3 at 99,187,646 bp
  • A to T, chromosome 3 at 155,087,403 bp
  • C to T, chromosome 4 at 118,830,216 bp
  • T to C, chromosome 4 at 131,818,925 bp
  • A to T, chromosome 4 at 135,418,542 bp
  • A to G, chromosome 5 at 38,227,946 bp
  • T to C, chromosome 5 at 110,729,831 bp
  • T to A, chromosome 5 at 114,226,867 bp
  • A to T, chromosome 5 at 122,428,303 bp
  • T to A, chromosome 6 at 5,185,334 bp
  • A to T, chromosome 6 at 29,207,162 bp
  • T to C, chromosome 6 at 32,251,065 bp
  • A to T, chromosome 6 at 40,878,810 bp
  • T to A, chromosome 6 at 141,754,456 bp
  • T to C, chromosome 6 at 142,790,295 bp
  • A to G, chromosome 7 at 19,856,337 bp
  • G to A, chromosome 7 at 29,399,524 bp
  • G to A, chromosome 7 at 101,663,997 bp
  • A to G, chromosome 7 at 103,154,874 bp
  • A to T, chromosome 7 at 126,370,323 bp
  • G to A, chromosome 8 at 25,817,614 bp
  • A to C, chromosome 9 at 13,621,619 bp
  • G to T, chromosome 9 at 38,430,331 bp
  • A to C, chromosome 9 at 103,432,657 bp
  • A to G, chromosome 9 at 114,330,397 bp
  • A to T, chromosome 11 at 3,927,546 bp
  • A to T, chromosome 11 at 54,639,783 bp
  • A to T, chromosome 11 at 62,349,310 bp
  • A to G, chromosome 11 at 69,795,845 bp
  • A to T, chromosome 11 at 72,303,430 bp
  • A to C, chromosome 11 at 78,400,532 bp
  • C to A, chromosome 11 at 78,836,135 bp
  • G to T, chromosome 11 at 100,626,040 bp
  • T to C, chromosome 12 at 50,388,255 bp
  • A to G, chromosome 12 at 77,364,997 bp
  • T to C, chromosome 12 at 88,175,913 bp
  • G to T, chromosome 12 at 118,110,952 bp
  • T to C, chromosome 14 at 34,146,707 bp
  • C to T, chromosome 15 at 98,529,425 bp
  • C to T, chromosome 15 at 99,521,251 bp
  • T to C, chromosome 15 at 101,816,312 bp
  • T to C, chromosome 16 at 84,828,440 bp
  • A to C, chromosome 17 at 8,566,697 bp
  • C to T, chromosome 17 at 12,894,373 bp
  • A to G, chromosome 17 at 25,845,133 bp
  • A to G, chromosome 17 at 25,846,407 bp
  • G to T, chromosome 17 at 33,137,472 bp
  • G to A, chromosome 17 at 87,708,583 bp
  • A to G, chromosome 18 at 37,690,507 bp
  • A to G, chromosome 18 at 61,977,904 bp
  • G to A, chromosome 18 at 62,994,983 bp
  • G to T, chromosome 18 at 67,421,259 bp
  • T to C, chromosome 19 at 4,287,897 bp
Genotype Determination
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5973 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044156-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.