Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5973Btlr/Mmmh
Stock Number:
044156-MU
Citation ID:
RRID:MMRRC_044156-MU
Other Names:
R5973 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Mbd5
Name: methyl-CpG binding domain protein 5
Synonyms: 9430004D19Rik, C030040A15Rik, OTTMUSG00000012483
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109241
Homologene: 81861
Spns1
Name: SPNS lysolipid transporter 1, lysophospholipid
Synonyms: 2210013K02Rik, spinster homolog
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73658
Homologene: 41530
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Kansl2
Name: KAT8 regulatory NSL complex subunit 2
Synonyms: 2310037I24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69612
VEGA: 15
Homologene: 32367
Ash2l
Name: ASH2 like histone lysine methyltransferase complex subunit
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23808
HGNC: HGNC:744
Homologene: 3436
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,156,857 bp
  • A to G, chromosome 1 at 36,702,081 bp
  • T to G, chromosome 1 at 74,416,033 bp
  • A to T, chromosome 1 at 119,418,076 bp
  • A to G, chromosome 1 at 132,434,411 bp
  • A to G, chromosome 1 at 150,563,817 bp
  • A to G, chromosome 1 at 151,402,949 bp
  • A to G, chromosome 1 at 172,219,501 bp
  • A to T, chromosome 2 at 25,364,630 bp
  • G to A, chromosome 2 at 31,420,323 bp
  • A to G, chromosome 2 at 49,272,389 bp
  • T to A, chromosome 2 at 69,068,625 bp
  • A to G, chromosome 2 at 111,135,369 bp
  • A to T, chromosome 2 at 120,328,705 bp
  • A to T, chromosome 2 at 127,337,288 bp
  • A to G, chromosome 2 at 150,267,935 bp
  • T to C, chromosome 2 at 153,402,011 bp
  • G to T, chromosome 3 at 31,038,456 bp
  • A to G, chromosome 3 at 54,315,842 bp
  • A to G, chromosome 3 at 55,783,112 bp
  • C to T, chromosome 3 at 83,922,246 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • A to G, chromosome 3 at 99,187,646 bp
  • A to T, chromosome 3 at 155,087,403 bp
  • C to T, chromosome 4 at 118,830,216 bp
  • T to C, chromosome 4 at 131,818,925 bp
  • A to T, chromosome 4 at 135,418,542 bp
  • A to G, chromosome 5 at 38,227,946 bp
  • T to C, chromosome 5 at 110,729,831 bp
  • T to A, chromosome 5 at 114,226,867 bp
  • A to T, chromosome 5 at 122,428,303 bp
  • T to A, chromosome 6 at 5,185,334 bp
  • A to T, chromosome 6 at 29,207,162 bp
  • T to C, chromosome 6 at 32,251,065 bp
  • A to T, chromosome 6 at 40,878,810 bp
  • T to A, chromosome 6 at 141,754,456 bp
  • T to C, chromosome 6 at 142,790,295 bp
  • A to G, chromosome 7 at 19,856,337 bp
  • G to A, chromosome 7 at 29,399,524 bp
  • G to A, chromosome 7 at 101,663,997 bp
  • A to G, chromosome 7 at 103,154,874 bp
  • A to T, chromosome 7 at 126,370,323 bp
  • G to A, chromosome 8 at 25,817,614 bp
  • A to C, chromosome 9 at 13,621,619 bp
  • G to T, chromosome 9 at 38,430,331 bp
  • A to C, chromosome 9 at 103,432,657 bp
  • A to G, chromosome 9 at 114,330,397 bp
  • A to T, chromosome 11 at 3,927,546 bp
  • A to T, chromosome 11 at 54,639,783 bp
  • A to T, chromosome 11 at 62,349,310 bp
  • A to G, chromosome 11 at 69,795,845 bp
  • A to T, chromosome 11 at 72,303,430 bp
  • A to C, chromosome 11 at 78,400,532 bp
  • C to A, chromosome 11 at 78,836,135 bp
  • G to T, chromosome 11 at 100,626,040 bp
  • T to C, chromosome 12 at 50,388,255 bp
  • A to G, chromosome 12 at 77,364,997 bp
  • T to C, chromosome 12 at 88,175,913 bp
  • G to T, chromosome 12 at 118,110,952 bp
  • T to C, chromosome 14 at 34,146,707 bp
  • C to T, chromosome 15 at 98,529,425 bp
  • C to T, chromosome 15 at 99,521,251 bp
  • T to C, chromosome 15 at 101,816,312 bp
  • T to C, chromosome 16 at 84,828,440 bp
  • A to C, chromosome 17 at 8,566,697 bp
  • C to T, chromosome 17 at 12,894,373 bp
  • A to G, chromosome 17 at 25,845,133 bp
  • A to G, chromosome 17 at 25,846,407 bp
  • G to T, chromosome 17 at 33,137,472 bp
  • G to A, chromosome 17 at 87,708,583 bp
  • A to G, chromosome 18 at 37,690,507 bp
  • A to G, chromosome 18 at 61,977,904 bp
  • G to A, chromosome 18 at 62,994,983 bp
  • G to T, chromosome 18 at 67,421,259 bp
  • T to C, chromosome 19 at 4,287,897 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5973 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044156-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.