Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5973Btlr/Mmmh
Stock Number:
044156-MU
Citation ID:
RRID:MMRRC_044156-MU
Other Names:
R5973 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Mbd5
Name: methyl-CpG binding domain protein 5
Synonyms: 9430004D19Rik, C030040A15Rik, OTTMUSG00000012483
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109241
Homologene: 81861
Spns1
Name: SPNS lysolipid transporter 1, lysophospholipid
Synonyms: 2210013K02Rik, spinster homolog
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73658
Homologene: 41530
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Kansl2
Name: KAT8 regulatory NSL complex subunit 2
Synonyms: 2310037I24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69612
VEGA: 15
Homologene: 32367
Ash2l
Name: ASH2 like histone lysine methyltransferase complex subunit
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23808
HGNC: HGNC:744
Homologene: 3436
Prkci
Name: protein kinase C, iota
Synonyms: Pkcl, Pkci, 2310021H13Rik, Prkcl, aPKClambda, PKClambda
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18759
HGNC: HGNC:9404
Homologene: 37667
Swt1
Name: SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms: 1200016B10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66875
Homologene: 32355
Rapgef6
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, RA-GEF-2, Pdzgef2, C030018K18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192786
Homologene: 22968
Msh2
Name: mutS homolog 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17685
HGNC: HGNC:7325
Homologene: 210
Sipa1l3
Name: signal-induced proliferation-associated 1 like 3
Synonyms: 2610511M17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74206
Homologene: 77938
Asxl1
Name: ASXL transcriptional regulator 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228790
Homologene: 9098
Pon1
Name: paraoxonase 1
Synonyms: Pon
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18979
HGNC: HGNC:9204
Homologene: 68058
Vps39
Name: VPS39 HOPS complex subunit
Synonyms: A230065P22Rik, Vam6P, Vam6, mVam6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269338
Homologene: 41025
Nkiras2
Name: NFKB inhibitor interacting Ras-like protein 2
Synonyms: 4930527H08Rik, KBRAS2, 2410003M04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71966
Homologene: 9738
Afg3l2
Name: AFG3-like AAA ATPase 2
Synonyms: 2310036I02Rik, par, Emv66
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 69597
VEGA: 18
HGNC: HGNC:315
Homologene: 4947
Clpb
Name: ClpB caseinolytic peptidase B
Synonyms: Skd3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20480
Homologene: 32067
Anapc7
Name: anaphase promoting complex subunit 7
Synonyms: prediabetic NOD sera-reactive autoantigen, APC7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56317
Homologene: 10512
Plxna4
Name: plexin A4
Synonyms: Plxa4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243743
HGNC: HGNC:9102
Homologene: 77587
Lyar
Name: Ly1 antibody reactive clone
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17089
Homologene: 41200
Atp5pf
Name: ATP synthase peripheral stalk subunit F6
Synonyms: Atp5j
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11957
HGNC: HGNC:847
Homologene: 1272
Fut8
Name: fucosyltransferase 8
Synonyms: alpha (1,6) fucosyltransferase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 53618
VEGA: 12
HGNC: HGNC:4019
Homologene: 9650
Maml2
Name: mastermind like transcriptional coactivator 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270118
Homologene: 134147
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b1279Clo, b2b1203Clo, b2b598Clo, b2b1289Clo, b2b1727Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Acacb
Name: acetyl-Coenzyme A carboxylase beta
Synonyms: Accb, Acc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100705
HGNC: HGNC:85
Homologene: 74382
Or8b42
Name: olfactory receptor family 8 subfamily B member 42
Synonyms: GA_x6K02T2PVTD-32123032-32123967, MOR162-8, Olfr901
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258028
VEGA: 9
Homologene: 79399
Npy4r
Name: neuropeptide Y receptor Y4
Synonyms: NYYR-D, Y4, Ppyr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19065
VEGA: 14
Homologene: 38119
Rcan3
Name: regulator of calcineurin 3
Synonyms: Csp3, Dscr1l2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53902
HGNC: HGNC:3042
Homologene: 8388
Pnldc1
Name: poly(A)-specific ribonuclease (PARN)-like domain containing 1
Synonyms: LOC240023
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240023
VEGA: 17
Homologene: 15054
Casq1
Name: calsequestrin 1
Synonyms: CSQ-1, CSQ1, CSQ, sCSQ
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12372
HGNC: HGNC:1512
Homologene: 20329
Morc2b
Name: microrchidia 2B
Synonyms: 4932411A10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240069
Homologene: 18615
Gm15130
Name: predicted gene 15130
Type: Gene
Species: Mouse
Chromosome: 2
Moxd2
Name: monooxygenase, DBH-like 2
Synonyms: Dbhl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194357
Homologene: 77226
Slc13a2
Name: solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2
Synonyms: sodium/dicarboxylate co-transporter, mNaDC-1, Nadc1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20500
Homologene: 2965
Sult6b2
Name: sulfotransferase family 6B, member 2
Synonyms: LOC330440, Gm766
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330440
Homologene: 66632
Impdh1
Name: inosine monophosphate dehydrogenase 1
Synonyms: B930086D20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 23917
HGNC: HGNC:6052
Homologene: 68096
Inhbb
Name: inhibin beta-B
Synonyms: activin beta-B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16324
HGNC: HGNC:6067
Homologene: 1654
Vil1
Name: villin 1
Synonyms: Villin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22349
Homologene: 5169
Wdr90
Name: WD repeat domain 90
Synonyms: 3230401M21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106618
Homologene: 27066
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213452
Homologene: 19711
Krt2
Name: keratin 2
Synonyms: Krt2-2, Krt2e, Krt2-17
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16681
HGNC: HGNC:6439
Tcn2
Name: transcobalamin 2
Synonyms: Tcn-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21452
Homologene: 303
Napg
Name: N-ethylmaleimide sensitive fusion protein attachment protein gamma
Synonyms: SNARE, 2400003O04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 108123
HGNC: HGNC:7642
Homologene: 2838
Ptpru
Name: protein tyrosine phosphatase receptor type U
Synonyms: Ptprl, RPTPlambda
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19273
HGNC: HGNC:9683
Homologene: 4168
Or10ak11
Name: olfactory receptor family 10 subfamily AK member 11
Synonyms: GA_x6K02T2QD9B-18703033-18703986, MOR259-11, MOR259-6, Olfr1333
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258265
Homologene: 134082
Bcl2a1c
Name: B cell leukemia/lymphoma 2 related protein A1c
Synonyms: A1-c
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12046
HGNC: HGNC:991
Prkd1
Name: protein kinase D1
Synonyms: Pkcm, PKD1, Prkcm
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18760
VEGA: 12
HGNC: HGNC:9407
Homologene: 55680
Chrnb1
Name: cholinergic receptor nicotinic beta 1 subunit
Synonyms: Achr-2, Acrb, AChR beta
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11443
HGNC: HGNC:1961
Homologene: 594
Bfsp2
Name: beaded filament structural protein 2, phakinin
Synonyms: CP49
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107993
HGNC: HGNC:1041
Homologene: 20791
Trpc4
Name: transient receptor potential cation channel, subfamily C, member 4
Synonyms: CCE1, Trp4, STRPC4, Trrp4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22066
Homologene: 22955
Wars2
Name: tryptophanyl tRNA synthetase 2 (mitochondrial)
Synonyms: 9430020O07Rik, TrpRS
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70560
Homologene: 5673
Cers6
Name: ceramide synthase 6
Synonyms: T1L, similar to TRH1, 4732462C07Rik, CerS6, Lass6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241447
Homologene: 72228
Uap1l1
Name: UDP-N-acetylglucosamine pyrophosphorylase 1 like 1
Synonyms: 5730445F03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227620
Homologene: 71313
Slco1a7
Name: solute carrier organic anion transporter family, member 1a7
Synonyms: Gm5724
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 435927
Faim2
Name: Fas apoptotic inhibitory molecule 2
Synonyms: NMP25, 2900002L20Rik, lifeguard, Lfg, Tmbim2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72393
VEGA: 15
Homologene: 8192
Hax1
Name: HCLS1 associated X-1
Synonyms: mHAX-1s, HAX-1, Silg111, Hs1bp1, HS1-associated protein X-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23897
Homologene: 4463
Sh3tc2
Name: SH3 domain and tetratricopeptide repeats 2
Synonyms: D430044G18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225608
VEGA: 18
Homologene: 11596
Actr1b
Name: ARP1 actin-related protein 1B, centractin beta
Synonyms: Arp1b, 2310066K23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226977
HGNC: HGNC:168
Homologene: 101541
Ceacam16
Name: CEA cell adhesion molecule 16
Synonyms: LOC330483
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330483
Homologene: 19857
Fpgt
Name: fucose-1-phosphate guanylyltransferase
Synonyms: 1700016E03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75540
HGNC: HGNC:3825
Homologene: 2847
Or52e2
Name: olfactory receptor family 52 subfamily E member 2
Synonyms: GA_x6K02T2PBJ9-5871256-5870303, MOR32-3, Olfr589
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259054
Homologene: 133046
Pcdhgb2
Name: protocadherin gamma subfamily B, 2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93700
HGNC: HGNC:8709
Homologene: 49571
Dusp2
Name: dual specificity phosphatase 2
Synonyms: PAC1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13537
HGNC: HGNC:3068
Homologene: 3255
Pramel51
Name: PRAME like 51
Synonyms: Gm10436
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039315
VEGA: 12
Homologene: 103830
D930015E06Rik
Name:
Type: Gene
Species: Mouse
Chromosome: 3
Lyrm9
Name: LYR motif containing 9
Synonyms: 1810012P15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66274
Homologene: 47720
Adrbk1
Name:
Type: Gene
Species: Mouse
Chromosome: 19
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,156,857 bp
  • A to G, chromosome 1 at 36,702,081 bp
  • T to G, chromosome 1 at 74,416,033 bp
  • A to T, chromosome 1 at 119,418,076 bp
  • A to G, chromosome 1 at 132,434,411 bp
  • A to G, chromosome 1 at 150,563,817 bp
  • A to G, chromosome 1 at 151,402,949 bp
  • A to G, chromosome 1 at 172,219,501 bp
  • A to T, chromosome 2 at 25,364,630 bp
  • G to A, chromosome 2 at 31,420,323 bp
  • A to G, chromosome 2 at 49,272,389 bp
  • T to A, chromosome 2 at 69,068,625 bp
  • A to G, chromosome 2 at 111,135,369 bp
  • A to T, chromosome 2 at 120,328,705 bp
  • A to T, chromosome 2 at 127,337,288 bp
  • A to G, chromosome 2 at 150,267,935 bp
  • T to C, chromosome 2 at 153,402,011 bp
  • G to T, chromosome 3 at 31,038,456 bp
  • A to G, chromosome 3 at 54,315,842 bp
  • A to G, chromosome 3 at 55,783,112 bp
  • C to T, chromosome 3 at 83,922,246 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • A to G, chromosome 3 at 99,187,646 bp
  • A to T, chromosome 3 at 155,087,403 bp
  • C to T, chromosome 4 at 118,830,216 bp
  • T to C, chromosome 4 at 131,818,925 bp
  • A to T, chromosome 4 at 135,418,542 bp
  • A to G, chromosome 5 at 38,227,946 bp
  • T to C, chromosome 5 at 110,729,831 bp
  • T to A, chromosome 5 at 114,226,867 bp
  • A to T, chromosome 5 at 122,428,303 bp
  • T to A, chromosome 6 at 5,185,334 bp
  • A to T, chromosome 6 at 29,207,162 bp
  • T to C, chromosome 6 at 32,251,065 bp
  • A to T, chromosome 6 at 40,878,810 bp
  • T to A, chromosome 6 at 141,754,456 bp
  • T to C, chromosome 6 at 142,790,295 bp
  • A to G, chromosome 7 at 19,856,337 bp
  • G to A, chromosome 7 at 29,399,524 bp
  • G to A, chromosome 7 at 101,663,997 bp
  • A to G, chromosome 7 at 103,154,874 bp
  • A to T, chromosome 7 at 126,370,323 bp
  • G to A, chromosome 8 at 25,817,614 bp
  • A to C, chromosome 9 at 13,621,619 bp
  • G to T, chromosome 9 at 38,430,331 bp
  • A to C, chromosome 9 at 103,432,657 bp
  • A to G, chromosome 9 at 114,330,397 bp
  • A to T, chromosome 11 at 3,927,546 bp
  • A to T, chromosome 11 at 54,639,783 bp
  • A to T, chromosome 11 at 62,349,310 bp
  • A to G, chromosome 11 at 69,795,845 bp
  • A to T, chromosome 11 at 72,303,430 bp
  • A to C, chromosome 11 at 78,400,532 bp
  • C to A, chromosome 11 at 78,836,135 bp
  • G to T, chromosome 11 at 100,626,040 bp
  • T to C, chromosome 12 at 50,388,255 bp
  • A to G, chromosome 12 at 77,364,997 bp
  • T to C, chromosome 12 at 88,175,913 bp
  • G to T, chromosome 12 at 118,110,952 bp
  • T to C, chromosome 14 at 34,146,707 bp
  • C to T, chromosome 15 at 98,529,425 bp
  • C to T, chromosome 15 at 99,521,251 bp
  • T to C, chromosome 15 at 101,816,312 bp
  • T to C, chromosome 16 at 84,828,440 bp
  • A to C, chromosome 17 at 8,566,697 bp
  • C to T, chromosome 17 at 12,894,373 bp
  • A to G, chromosome 17 at 25,845,133 bp
  • A to G, chromosome 17 at 25,846,407 bp
  • G to T, chromosome 17 at 33,137,472 bp
  • G to A, chromosome 17 at 87,708,583 bp
  • A to G, chromosome 18 at 37,690,507 bp
  • A to G, chromosome 18 at 61,977,904 bp
  • G to A, chromosome 18 at 62,994,983 bp
  • G to T, chromosome 18 at 67,421,259 bp
  • T to C, chromosome 19 at 4,287,897 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5973 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044156-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.