Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5978Btlr/Mmmh
Stock Number:
044160-MU
Citation ID:
RRID:MMRRC_044160-MU
Other Names:
R5978 (G1)
Major Collection:

Strain Information

Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: PRCE, separase, SSE, ESP1, PRCE, Cerp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105988
VEGA: 15
Homologene: 32151
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Hnrnpll
Name: heterogeneous nuclear ribonucleoprotein L-like
Synonyms: 2510028H02Rik, 2810036L13Rik, Hnrpll
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72692
Homologene: 26701
Ncapg2
Name: non-SMC condensin II complex, subunit G2
Synonyms: Mtb, 5830426I05Rik, Luzp5, mCAP-G2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76044
VEGA: 12
Homologene: 9820
Iars1
Name: isoleucyl-tRNA synthetase 1
Synonyms: E430001P04Rik, 2510016L12Rik, Iars
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Syt9
Name: synaptotagmin IX
Synonyms: Sytv
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 60510
Homologene: 11062
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Rnf115
Name: ring finger protein 115
Synonyms: 2610028E05Rik, Zfp364, Rabring7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67845
Homologene: 69167
Ube2v2
Name: ubiquitin-conjugating enzyme E2 variant 2
Synonyms: MMS2, 5730524P06Rik, 4632410D19Rik, 1110021H13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70620
Homologene: 55739
Eif5b
Name: eukaryotic translation initiation factor 5B
Synonyms: IF2, A030003E17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226982
Homologene: 134613
Heatr5b
Name: HEAT repeat containing 5B
Synonyms: D330050P16Rik, 2010013B10Rik, A230048G03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320473
VEGA: 17
Homologene: 25536
Mctp2
Name: multiple C2 domains, transmembrane 2
Synonyms: LOC244049
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244049
Homologene: 69254
Kel
Name: Kell blood group
Synonyms: CD238
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 23925
HGNC: HGNC:6308
Homologene: 362
Cst3
Name: cystatin C
Synonyms: CysC
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13010
HGNC: HGNC:2475
Homologene: 78
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Fstl5
Name: follistatin-like 5
Synonyms: 9130207J01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213262
Homologene: 10584
Nlrp9a
Name: NLR family, pyrin domain containing 9A
Synonyms: D7Ertd565e, Nalp9a, Nalp-theta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233001
Homologene: 116072
Mrc1
Name: mannose receptor, C type 1
Synonyms: CD206, MR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17533
HGNC: HGNC:7228
Homologene: 37622
Cyp2j11
Name: cytochrome P450, family 2, subfamily j, polypeptide 11
Synonyms: Cyp2j11-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100066
HGNC: HGNC:2634
Homologene: 133819
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Slc4a9
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 9
Synonyms: AE4, D630024F24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240215
VEGA: 18
Homologene: 23732
Atp2c2
Name: ATPase, Ca++ transporting, type 2C, member 2
Synonyms: 1810010G06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69047
Homologene: 73463
Slc4a5
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 5
Synonyms: C330016K18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232156
Homologene: 31125
Nlrc5
Name: NLR family, CARD domain containing 5
Synonyms: AI451557
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434341
Homologene: 88935
Ccdc146
Name: coiled-coil domain containing 146
Synonyms: 4930528G09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75172
Homologene: 67159
Or1j17
Name: olfactory receptor family 1 subfamily J member 17
Synonyms: GA_x6K02T2NLDC-33382467-33383396, MOR136-11, Olfr346
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258940
Homologene: 133616
Krt84
Name: keratin 84
Synonyms: HRb-1, Krt2-3, Krt2-16
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16680
VEGA: 15
HGNC: HGNC:6461
Homologene: 22473
Myom1
Name: myomesin 1
Synonyms: skelemin, D430047A17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17929
VEGA: 17
HGNC: HGNC:7613
Homologene: 31196
Zfp91
Name: zinc finger protein 91
Synonyms: Pzf, 9130014I08Rik, A530054C17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109910
Homologene: 43144
Krt77
Name: keratin 77
Synonyms: 4732484G22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 406220
Homologene: 45490
Scel
Name: sciellin
Synonyms: 9230114I02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64929
VEGA: 14
Homologene: 2850
Parp8
Name: poly (ADP-ribose) polymerase family, member 8
Synonyms: 2810430O08Rik, D13Ertd275e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 52552
VEGA: 13
Homologene: 11621
Il34
Name: interleukin 34
Synonyms: 2010004A03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76527
Homologene: 12648
Anks6
Name: ankyrin repeat and sterile alpha motif domain containing 6
Synonyms: LOC269533, 2210417J20Rik, Samd6, SamCystin, b2b1801.1Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75691
Homologene: 19545
Nkain3
Name: Na+/K+ transporting ATPase interacting 3
Synonyms: E130310K16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269513
Homologene: 18265
Hax1
Name: HCLS1 associated X-1
Synonyms: mHAX-1s, HAX-1, Silg111, Hs1bp1, HS1-associated protein X-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23897
Homologene: 4463
Vmn1r14
Name: vomeronasal 1 receptor 14
Synonyms: V1rc7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113864
Homologene: 74373
Wdr81
Name: WD repeat domain 81
Synonyms: shakey 5, MGC32441, nur5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192652
Homologene: 13983
Ptgr2
Name: prostaglandin reductase 2
Synonyms: B830026H24Rik, 9630002F03Rik, 1810016I24Rik, PGR-2, Zadh1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 77219
Homologene: 39824
Gm11011
Name: predicted gene 11011
Type: Gene
Species: Mouse
Chromosome: 2
Spint4
Name: serine protease inhibitor, Kunitz type 4
Synonyms: Spint4, 9230105I15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78239
Homologene: 49932
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 37,998,280 bp
  • A to T, chromosome 2 at 14,315,393 bp
  • A to C, chromosome 2 at 36,688,682 bp
  • T to C, chromosome 2 at 76,808,799 bp
  • T to A, chromosome 2 at 112,672,269 bp
  • A to T, chromosome 2 at 148,872,821 bp
  • T to G, chromosome 2 at 148,872,822 bp
  • C to T, chromosome 2 at 164,700,332 bp
  • T to C, chromosome 2 at 169,584,441 bp
  • C to T, chromosome 3 at 76,145,085 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • T to A, chromosome 3 at 96,788,666 bp
  • A to T, chromosome 4 at 20,485,026 bp
  • T to A, chromosome 4 at 47,049,252 bp
  • A to C, chromosome 4 at 96,319,352 bp
  • T to C, chromosome 4 at 145,122,611 bp
  • T to G, chromosome 5 at 21,316,968 bp
  • T to A, chromosome 6 at 41,688,045 bp
  • C to T, chromosome 6 at 57,233,944 bp
  • T to A, chromosome 6 at 83,277,536 bp
  • T to A, chromosome 7 at 26,557,278 bp
  • T to C, chromosome 7 at 45,694,013 bp
  • T to C, chromosome 7 at 72,090,188 bp
  • T to A, chromosome 7 at 107,436,413 bp
  • A to T, chromosome 8 at 94,488,593 bp
  • T to A, chromosome 8 at 110,742,685 bp
  • G to A, chromosome 8 at 119,749,875 bp
  • G to A, chromosome 11 at 75,444,398 bp
  • T to A, chromosome 11 at 79,540,419 bp
  • G to T, chromosome 12 at 84,295,258 bp
  • T to C, chromosome 12 at 116,424,671 bp
  • T to A, chromosome 13 at 49,722,993 bp
  • A to C, chromosome 13 at 116,895,732 bp
  • A to G, chromosome 14 at 103,529,254 bp
  • T to C, chromosome 15 at 101,530,230 bp
  • T to C, chromosome 15 at 101,862,928 bp
  • A to G, chromosome 15 at 102,315,774 bp
  • T to C, chromosome 16 at 15,577,127 bp
  • T to A, chromosome 16 at 38,591,030 bp
  • A to T, chromosome 17 at 71,117,443 bp
  • C to A, chromosome 17 at 78,806,036 bp
  • G to A, chromosome 17 at 80,034,191 bp
  • T to G, chromosome 18 at 36,535,403 bp
  • A to G, chromosome 19 at 12,770,151 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5978 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044160-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.