Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5978Btlr/Mmmh
Stock Number:
044160-MU
Citation ID:
RRID:MMRRC_044160-MU
Other Names:
R5978 (G1)
Major Collection:

Strain Information

Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: separase, SSE, ESP1, PRCE, PRCE, Cerp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105988
VEGA: 15
Homologene: 32151
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Hnrnpll
Name: heterogeneous nuclear ribonucleoprotein L-like
Synonyms: 2510028H02Rik, 2810036L13Rik, Hnrpll
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72692
Homologene: 26701
Ncapg2
Name: non-SMC condensin II complex, subunit G2
Synonyms: Mtb, 5830426I05Rik, Luzp5, mCAP-G2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76044
VEGA: 12
Homologene: 9820
Iars1
Name: isoleucyl-tRNA synthetase 1
Synonyms: E430001P04Rik, 2510016L12Rik, Iars
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105148
HGNC: HGNC:5330
Homologene: 5325
Syt9
Name: synaptotagmin IX
Synonyms: Sytv
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 60510
Homologene: 11062
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 37,998,280 bp
  • A to T, chromosome 2 at 14,315,393 bp
  • A to C, chromosome 2 at 36,688,682 bp
  • T to C, chromosome 2 at 76,808,799 bp
  • T to A, chromosome 2 at 112,672,269 bp
  • A to T, chromosome 2 at 148,872,821 bp
  • T to G, chromosome 2 at 148,872,822 bp
  • C to T, chromosome 2 at 164,700,332 bp
  • T to C, chromosome 2 at 169,584,441 bp
  • C to T, chromosome 3 at 76,145,085 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • T to A, chromosome 3 at 96,788,666 bp
  • A to T, chromosome 4 at 20,485,026 bp
  • T to A, chromosome 4 at 47,049,252 bp
  • A to C, chromosome 4 at 96,319,352 bp
  • T to C, chromosome 4 at 145,122,611 bp
  • T to G, chromosome 5 at 21,316,968 bp
  • T to A, chromosome 6 at 41,688,045 bp
  • C to T, chromosome 6 at 57,233,944 bp
  • T to A, chromosome 6 at 83,277,536 bp
  • T to A, chromosome 7 at 26,557,278 bp
  • T to C, chromosome 7 at 45,694,013 bp
  • T to C, chromosome 7 at 72,090,188 bp
  • T to A, chromosome 7 at 107,436,413 bp
  • A to T, chromosome 8 at 94,488,593 bp
  • T to A, chromosome 8 at 110,742,685 bp
  • G to A, chromosome 8 at 119,749,875 bp
  • G to A, chromosome 11 at 75,444,398 bp
  • T to A, chromosome 11 at 79,540,419 bp
  • G to T, chromosome 12 at 84,295,258 bp
  • T to C, chromosome 12 at 116,424,671 bp
  • T to A, chromosome 13 at 49,722,993 bp
  • A to C, chromosome 13 at 116,895,732 bp
  • A to G, chromosome 14 at 103,529,254 bp
  • T to C, chromosome 15 at 101,530,230 bp
  • T to C, chromosome 15 at 101,862,928 bp
  • A to G, chromosome 15 at 102,315,774 bp
  • T to C, chromosome 16 at 15,577,127 bp
  • T to A, chromosome 16 at 38,591,030 bp
  • A to T, chromosome 17 at 71,117,443 bp
  • C to A, chromosome 17 at 78,806,036 bp
  • G to A, chromosome 17 at 80,034,191 bp
  • T to G, chromosome 18 at 36,535,403 bp
  • A to G, chromosome 19 at 12,770,151 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5978 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044160-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.