Strain Name:
C57BL/6J-MtgxR6034Btlr
Stock Number:
044206-MU
Citation ID:
RRID:MMRRC_044206-MU
Other Names:
R6034 (G1)
Major Collection:

Gene Information

Phf12
Name: PHD finger protein 12
Synonyms: 2410142K10Rik, PF1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 268448
Homologene: 10841
Pard3
Name: par-3 family cell polarity regulator
Synonyms: Pard3a, PAR-3, Par3, ASIP, D8Ertd580e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 93742
Homologene: 10489
Naa15
Name: N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Synonyms: Narg1, tubedown, mNAT1, ASTBDN, Tbdn-1, 5730450D16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 74838
Homologene: 14211
Sec23ip
Name: Sec23 interacting protein
Synonyms: p125, D7Ertd373e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 207352
Homologene: 38288
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, D630005A10Rik, A430040A19Rik, Bruce, A430032G04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 12211
Homologene: 7248
Zc3h14
Name: zinc finger CCCH type containing 14
Synonyms: 1700016A15Rik, 2700069A02Rik, 1010001P15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 75553
VEGA: 12
Homologene: 32605
Sap130
Name: Sin3A associated protein
Synonyms: 2610304F09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 269003
VEGA: 18
Homologene: 11577
Prom1
Name: prominin 1
Synonyms: Prom-1, 4932416E19Rik, AC133, Prom, CD133
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 19126
HGNC: HGNC:9454
Homologene: 4390
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: E430018P19Rik, 8030453L17Rik, KMT2H, chromatin remodeling factor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 192195
Homologene: 10225
Gapdh
Name: glyceraldehyde-3-phosphate dehydrogenase
Synonyms: Gapd, Gapd
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 14433
HGNC: HGNC:4141
Homologene: 107053
Hspbp1
Name: HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Synonyms: 1500019G21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 66245
Homologene: 40827
Col4a3bp
Name: collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
Synonyms: GPBP, 2810404O15Rik, 9230101K08Rik, ceramide transport protein, Cert
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 68018
VEGA: 13
HGNC: HGNC:2205
Homologene: 4173
Atad2
Name: ATPase family, AAA domain containing 2
Synonyms: 2610509G12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 70472
VEGA: 15
Homologene: 6044
Atp6v1c2
Name: ATPase, H+ transporting, lysosomal V1 subunit C2
Synonyms: 1110038G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 68775
Homologene: 15866
Atp2b4
Name: ATPase, Ca++ transporting, plasma membrane 4
Synonyms: PMCA4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 381290
HGNC: HGNC:817
Homologene: 48034
Cdipt
Name: CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)
Synonyms: D7Bwg0575e, 9530042F15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 52858
HGNC: HGNC:1769
Homologene: 7159
Pcdhgb8
Name: protocadherin gamma subfamily B, 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 93705
Homologene: 81868
Mink1
Name: misshapen-like kinase 1 (zebrafish)
Synonyms: Ysk2, Map4k6, MINK, Misshapen/NIKs-related kinase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 50932
Homologene: 56762
Synm
Name: synemin, intermediate filament protein
Synonyms: Synemin, 4930412K21Rik, Dmn
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233335
Homologene: 9081
Mtrf1l
Name: mitochondrial translational release factor 1-like
Synonyms: 9130004K12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 108853
Homologene: 5905
Pcdha1
Name: protocadherin alpha 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 116731
HGNC: HGNC:8663
Homologene: 75093
Zc3hav1l
Name: zinc finger CCCH-type, antiviral 1-like
Synonyms: B130055L09Rik, E430016P22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 209032
Homologene: 15425
Olfr1303
Name: olfactory receptor 1303
Synonyms: MOR245-7, Olfr276, MOR245-28_p, MOR245-7, GA_x6K02T2Q125-72882187-72881249, GA_x6K02T2N82Q-3465-3764
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258397
Homologene: 88429
Arhgef4
Name: Rho guanine nucleotide exchange factor (GEF) 4
Synonyms: Asef, C230030N03Rik, 9330140K16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 226970
HGNC: HGNC:684
Homologene: 49414
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: 4732433M03Rik, CPS, D1Ucla3, CPSase I
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Myo5c
Name: myosin VC
Synonyms: 9130003O20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 208943
VEGA: 9
HGNC: HGNC:7604
Homologene: 135711
Ccdc40
Name: coiled-coil domain containing 40
Synonyms: B930008I02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 207607
Homologene: 27890
Itprid1
Name: ITPR interacting domain containing 1
Synonyms: Ccdc129, D530004J12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 232016
Homologene: 52344
Sec16b
Name: SEC16 homolog B (S. cerevisiae)
Synonyms: Lztr2, Rgpr-p117, Rgpr
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 89867
Homologene: 13227
Zfp563
Name: zinc finger protein 563
Synonyms: Zfp413, zinc finger protein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 240068
Homologene: 77346
Cfh
Name: complement component factor h
Synonyms: Sas1, Sas-1, Mud-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Luzp2
Name: leucine zipper protein 2
Synonyms: 9330154K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233271
Homologene: 45618
Hmgxb3
Name: HMG box domain containing 3
Synonyms: 2510002C16Rik, A630042L21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 106894
VEGA: 18
Homologene: 44229
Slc22a15
Name: solute carrier family 22 (organic anion/cation transporter), member 15
Synonyms: A530052I06Rik, 2610034P21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 242126
Homologene: 41263
Ugt2b36
Name: UDP glucuronosyltransferase 2 family, polypeptide B36
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 231396
Homologene: 128251
Kcnip4
Name: Kv channel interacting protein 4
Synonyms: Calp250, KChIP4a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 80334
Homologene: 23528
Lilra5
Name: leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Synonyms: Gm4878
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 232801
Homologene: 83297
H2-Ob
Name: histocompatibility 2, O region beta locus
Synonyms: H2-IAb2, A-beta2, Ob, vic1, H2-Ab, H-2I, H-2Ob, A-beta-2, H2-Ab2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 15002
HGNC: HGNC:4937
Homologene: 1602
Mpp2
Name: membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Synonyms: Dlgh2, Pals4, Dlg2, D11Bwg0652e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 50997
HGNC: HGNC:7220
Homologene: 3920
St6gal2
Name: beta galactoside alpha 2,6 sialyltransferase 2
Synonyms: ST6Gal II, C230064G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 240119
Homologene: 13052
Stard13
Name: StAR-related lipid transfer (START) domain containing 13
Synonyms: DLC2, GT650
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 243362
Homologene: 64844
Tc2n
Name: tandem C2 domains, nuclear
Synonyms: 4933406D09Rik, Mtac2d1, Tac2-N
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 74413
Homologene: 12560
Catsperb
Name: cation channel sperm associated auxiliary subunit beta
Synonyms: 4932415G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 271036
VEGA: 12
Homologene: 81904
Fastkd3
Name: FAST kinase domains 3
Synonyms: 2310010B21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 69577
VEGA: 13
Homologene: 11457
Selenoo
Name: selenoprotein O
Synonyms: Selo, 1300018J18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223776
Homologene: 69439
Olfr1
Name: olfactory receptor 1
Synonyms: I54, MOR135-13, GA_x6K02T2P1NL-3556334-3555390
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 258923
Homologene: 115482
Oosp2
Name: oocyte secreted protein 2
Synonyms: LOC225922, Plac1l, Tmem122
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 225922
Homologene: 52157
Vmn1r65
Name: vomeronasal 1 receptor 65
Synonyms: V1rd6, V3R6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 81013
Homologene: 110799
Ccin
Name: calicin
Synonyms: 4933417A14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 442829
HGNC: HGNC:1568
Homologene: 4306
Dnah7c
Name: dynein, axonemal, heavy chain 7C
Synonyms: Dnahc7c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 100101919
Homologene: 41287
Map10
Name: microtubule-associated protein 10
Synonyms: 4933403G14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 74393
Homologene: 10416
Lipf
Name: lipase, gastric
Synonyms: 2310051B21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 67717
HGNC: HGNC:6622
Homologene: 68139
Imp4
Name: IMP4, U3 small nucleolar ribonucleoprotein
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 27993
Homologene: 68891
Hist1h1e
Name: histone cluster 1, H1e
Synonyms: H1f4, H1-4, H1var2, H1s-4, H1e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 50709
HGNC: HGNC:4718
Homologene: 137314
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Gm13318, Diet1, Gm13364
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 102635496
Homologene: 136214
Raet1e
Name: retinoic acid early transcript 1E
Synonyms: Rae-1 epsilon
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 379043
Homologene: 134115
Lsm7
Name: LSM7 homolog, U6 small nuclear RNA and mRNA degradation associated
Synonyms: 0910001B06Rik, 1110033F18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 66094
VEGA: 10
Homologene: 6781
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,443,456 bp
  • G to T, chromosome 1 at 34,721,903 bp
  • A to T, chromosome 1 at 46,457,258 bp
  • T to A, chromosome 1 at 67,157,713 bp
  • T to A, chromosome 1 at 133,731,907 bp
  • T to C, chromosome 1 at 140,163,131 bp
  • A to T, chromosome 1 at 157,552,939 bp
  • T to A, chromosome 2 at 15,845,326 bp
  • T to A, chromosome 2 at 111,814,357 bp
  • A to G, chromosome 3 at 51,442,821 bp
  • T to C, chromosome 3 at 88,985,019 bp
  • A to G, chromosome 3 at 101,862,919 bp
  • G to A, chromosome 4 at 43,985,354 bp
  • T to A, chromosome 5 at 44,044,408 bp
  • G to T, chromosome 5 at 48,390,941 bp
  • T to A, chromosome 5 at 87,081,518 bp
  • A to T, chromosome 5 at 151,095,500 bp
  • C to A, chromosome 6 at 38,295,280 bp
  • T to A, chromosome 6 at 55,967,681 bp
  • T to C, chromosome 6 at 125,165,298 bp
  • T to C, chromosome 7 at 4,242,134 bp
  • A to T, chromosome 7 at 4,677,712 bp
  • A to G, chromosome 7 at 6,008,869 bp
  • T to A, chromosome 7 at 55,167,224 bp
  • A to G, chromosome 7 at 67,734,905 bp
  • T to G, chromosome 7 at 126,978,325 bp
  • C to T, chromosome 7 at 128,750,203 bp
  • T to C, chromosome 8 at 125,672,466 bp
  • C to G, chromosome 8 at 127,064,327 bp
  • A to T, chromosome 9 at 75,255,905 bp
  • T to A, chromosome 10 at 5,823,834 bp
  • A to G, chromosome 10 at 22,182,091 bp
  • T to C, chromosome 10 at 80,852,908 bp
  • AAGCAGCAGCAGCAGCAGCAGCAG to AAGCAGCAGCAGCAGCAGCAG, chromosome 11 at 70,607,040 bp
  • AGCGGTCGTAGGC to AGC, chromosome 11 at 73,395,654 bp
  • A to G, chromosome 11 at 78,018,069 bp
  • T to C, chromosome 11 at 102,061,634 bp
  • A to G, chromosome 11 at 119,243,072 bp
  • C to A, chromosome 12 at 17,307,500 bp
  • T to C, chromosome 12 at 98,771,373 bp
  • A to G, chromosome 12 at 101,575,832 bp
  • A to T, chromosome 12 at 101,651,201 bp
  • A to G, chromosome 13 at 23,622,313 bp
  • T to A, chromosome 13 at 68,583,610 bp
  • A to C, chromosome 13 at 96,609,800 bp
  • A to T, chromosome 15 at 58,108,563 bp
  • A to G, chromosome 15 at 89,099,343 bp
  • G to A, chromosome 17 at 33,104,961 bp
  • T to C, chromosome 17 at 34,241,218 bp
  • T to A, chromosome 17 at 55,482,981 bp
  • T to A, chromosome 17 at 74,615,283 bp
  • T to C, chromosome 18 at 31,689,406 bp
  • T to A, chromosome 18 at 36,930,598 bp
  • A to G, chromosome 18 at 37,762,548 bp
  • T to A, chromosome 18 at 61,132,522 bp
  • A to G, chromosome 19 at 11,651,515 bp
  • T to C, chromosome 19 at 33,964,889 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6034 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
044206-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.