Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6034Btlr/Mmmh
Stock Number:
044206-MU
Citation ID:
RRID:MMRRC_044206-MU
Other Names:
R6034 (G1)
Major Collection:

Strain Information

Phf12
Name: PHD finger protein 12
Synonyms: PF1, 2410142K10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268448
Homologene: 10841
Pard3
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93742
Homologene: 10489
Naa15
Name: N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Synonyms: tubedown, Tbdn-1, mNAT1, 5730450D16Rik, Narg1, ASTBDN
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74838
Homologene: 14211
Sec23ip
Name: Sec23 interacting protein
Synonyms: D7Ertd373e, p125
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207352
Homologene: 38288
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Zc3h14
Name: zinc finger CCCH type containing 14
Synonyms: 1700016A15Rik, 1010001P15Rik, 2700069A02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75553
VEGA: 12
Homologene: 32605
Sap130
Name: Sin3A associated protein 130
Synonyms: 2610304F09Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269003
VEGA: 18
Homologene: 11577
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,443,456 bp
  • G to T, chromosome 1 at 34,721,903 bp
  • A to T, chromosome 1 at 46,457,258 bp
  • T to A, chromosome 1 at 67,157,713 bp
  • T to A, chromosome 1 at 133,731,907 bp
  • T to C, chromosome 1 at 140,163,131 bp
  • A to T, chromosome 1 at 157,552,939 bp
  • T to A, chromosome 2 at 15,845,326 bp
  • T to A, chromosome 2 at 111,814,357 bp
  • A to G, chromosome 3 at 51,442,821 bp
  • T to C, chromosome 3 at 88,985,019 bp
  • A to G, chromosome 3 at 101,862,919 bp
  • G to A, chromosome 4 at 43,985,354 bp
  • T to A, chromosome 5 at 44,044,408 bp
  • G to T, chromosome 5 at 48,390,941 bp
  • T to A, chromosome 5 at 87,081,518 bp
  • A to T, chromosome 5 at 151,095,500 bp
  • C to A, chromosome 6 at 38,295,280 bp
  • T to A, chromosome 6 at 55,967,681 bp
  • T to C, chromosome 6 at 125,165,298 bp
  • T to C, chromosome 7 at 4,242,134 bp
  • A to T, chromosome 7 at 4,677,712 bp
  • A to G, chromosome 7 at 6,008,869 bp
  • T to A, chromosome 7 at 55,167,224 bp
  • A to G, chromosome 7 at 67,734,905 bp
  • T to G, chromosome 7 at 126,978,325 bp
  • C to T, chromosome 7 at 128,750,203 bp
  • T to C, chromosome 8 at 125,672,466 bp
  • C to G, chromosome 8 at 127,064,327 bp
  • A to T, chromosome 9 at 75,255,905 bp
  • T to A, chromosome 10 at 5,823,834 bp
  • A to G, chromosome 10 at 22,182,091 bp
  • T to C, chromosome 10 at 80,852,908 bp
  • AAGCAGCAGCAGCAGCAGCAGCAG to AAGCAGCAGCAGCAGCAGCAG, chromosome 11 at 70,607,040 bp
  • AGCGGTCGTAGGC to AGC, chromosome 11 at 73,395,654 bp
  • A to G, chromosome 11 at 78,018,069 bp
  • T to C, chromosome 11 at 102,061,634 bp
  • A to G, chromosome 11 at 119,243,072 bp
  • C to A, chromosome 12 at 17,307,500 bp
  • T to C, chromosome 12 at 98,771,373 bp
  • A to G, chromosome 12 at 101,575,832 bp
  • A to T, chromosome 12 at 101,651,201 bp
  • A to G, chromosome 13 at 23,622,313 bp
  • T to A, chromosome 13 at 68,583,610 bp
  • A to C, chromosome 13 at 96,609,800 bp
  • A to T, chromosome 15 at 58,108,563 bp
  • A to G, chromosome 15 at 89,099,343 bp
  • G to A, chromosome 17 at 33,104,961 bp
  • T to C, chromosome 17 at 34,241,218 bp
  • T to A, chromosome 17 at 55,482,981 bp
  • T to A, chromosome 17 at 74,615,283 bp
  • T to C, chromosome 18 at 31,689,406 bp
  • T to A, chromosome 18 at 36,930,598 bp
  • A to G, chromosome 18 at 37,762,548 bp
  • T to A, chromosome 18 at 61,132,522 bp
  • A to G, chromosome 19 at 11,651,515 bp
  • T to C, chromosome 19 at 33,964,889 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6034 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044206-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.