Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6034Btlr/Mmmh
Stock Number:
044206-MU
Citation ID:
RRID:MMRRC_044206-MU
Other Names:
R6034 (G1)
Major Collection:

Strain Information

Phf12
Name: PHD finger protein 12
Synonyms: PF1, 2410142K10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268448
Homologene: 10841
Pard3
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93742
Homologene: 10489
Naa15
Name: N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Synonyms: tubedown, Tbdn-1, mNAT1, 5730450D16Rik, Narg1, ASTBDN
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74838
Homologene: 14211
Sec23ip
Name: Sec23 interacting protein
Synonyms: D7Ertd373e, p125
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207352
Homologene: 38288
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Zc3h14
Name: zinc finger CCCH type containing 14
Synonyms: 1700016A15Rik, 1010001P15Rik, 2700069A02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75553
VEGA: 12
Homologene: 32605
Sap130
Name: Sin3A associated protein
Synonyms: 2610304F09Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269003
VEGA: 18
Homologene: 11577
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Gapdh
Name: glyceraldehyde-3-phosphate dehydrogenase
Synonyms: Gapd, Gapd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14433
HGNC: HGNC:4141
Homologene: 107053
Hspbp1
Name: HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Synonyms: 1500019G21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66245
Homologene: 40827
Cert1
Name: ceramide transporter 1
Synonyms: 2810404O15Rik, GPBP, 9230101K08Rik, Cert, ceramide transport protein, Col4a3bp
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68018
VEGA: 13
HGNC: HGNC:2205
Homologene: 4173
Atad2
Name: ATPase family, AAA domain containing 2
Synonyms: 2610509G12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70472
VEGA: 15
Homologene: 6044
Atp6v1c2
Name: ATPase, H+ transporting, lysosomal V1 subunit C2
Synonyms: 1110038G14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68775
Homologene: 15866
Atp2b4
Name: ATPase, Ca++ transporting, plasma membrane 4
Synonyms: PMCA4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381290
HGNC: HGNC:817
Homologene: 48034
Cdipt
Name: CDP-diacylglycerol--inositol 3-phosphatidyltransferase
Synonyms: 9530042F15Rik, D7Bwg0575e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52858
HGNC: HGNC:1769
Homologene: 7159
Pcdhgb8
Name: protocadherin gamma subfamily B, 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93705
HGNC: HGNC:8715
Homologene: 81868
Mink1
Name: misshapen-like kinase 1 (zebrafish)
Synonyms: Misshapen/NIKs-related kinase, MINK, Ysk2, Map4k6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50932
Homologene: 56762
Synm
Name: synemin, intermediate filament protein
Synonyms: 4930412K21Rik, Synemin, Dmn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233335
Homologene: 9081
Mtrf1l
Name: mitochondrial translational release factor 1-like
Synonyms: 9130004K12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108853
Homologene: 5905
Pcdha1
Name: protocadherin alpha 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 116731
HGNC: HGNC:8663
Homologene: 75093
Zc3hav1l
Name: zinc finger CCCH-type, antiviral 1-like
Synonyms: B130055L09Rik, E430016P22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209032
Homologene: 15425
Or4f7
Name: olfactory receptor family 4 subfamily F member 7
Synonyms: GA_x6K02T2N82Q-3465-3764, GA_x6K02T2Q125-72882187-72881249, MOR245-28_p, MOR245-7, MOR245-7, Olfr276, Olfr1303
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258397
Homologene: 88429
Arhgef4
Name: Rho guanine nucleotide exchange factor 4
Synonyms: 9330140K16Rik, Asef, C230030N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226970
HGNC: HGNC:684
Homologene: 49414
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: CPS, CPSase I, 4732433M03Rik, D1Ucla3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Myo5c
Name: myosin VC
Synonyms: 9130003O20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208943
VEGA: 9
HGNC: HGNC:7604
Homologene: 135711
Ccdc40
Name: coiled-coil domain containing 40
Synonyms: B930008I02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207607
Homologene: 27890
Itprid1
Name: ITPR interacting domain containing 1
Synonyms: D530004J12Rik, Ccdc129
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232016
Homologene: 52344
Sec16b
Name: SEC16 homolog B, endoplasmic reticulum export factor
Synonyms: Rgpr-p117, Rgpr, Lztr2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 89867
Homologene: 13227
Zfp563
Name: zinc finger protein 563
Synonyms: zinc finger protein, Zfp413
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240068
Homologene: 77346
Cfh
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Luzp2
Name: leucine zipper protein 2
Synonyms: 9330154K17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233271
Homologene: 45618
Hmgxb3
Name: HMG box domain containing 3
Synonyms: 2510002C16Rik, A630042L21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106894
VEGA: 18
Homologene: 44229
Slc22a15
Name: solute carrier family 22 (organic anion/cation transporter), member 15
Synonyms: 2610034P21Rik, A530052I06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242126
Homologene: 41263
Kcnip4
Name: Kv channel interacting protein 4
Synonyms: Calp250, KChIP4a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80334
Homologene: 23528
Lilra5
Name: leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
Synonyms: Gm4878
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232801
Homologene: 83297
H2-Ob
Name: histocompatibility 2, O region beta locus
Synonyms: Ob, H-2I, H2-IAb2, H2-Ab, H-2Ob, H2-Ab2, A-beta2, A-beta-2, vic1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15002
HGNC: HGNC:4937
Homologene: 1602
Mpp2
Name: membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Synonyms: Dlg2, Dlgh2, Pals4, D11Bwg0652e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50997
HGNC: HGNC:7220
Homologene: 3920
St6gal2
Name: beta galactoside alpha 2,6 sialyltransferase 2
Synonyms: C230064G14Rik, ST6Gal II
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240119
Homologene: 13052
Stard13
Name: StAR related lipid transfer domain containing 13
Synonyms: GT650, DLC2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243362
Homologene: 64844
Tc2n
Name: tandem C2 domains, nuclear
Synonyms: 4933406D09Rik, Tac2-N, Mtac2d1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74413
Homologene: 12560
Catsperb
Name: cation channel sperm associated auxiliary subunit beta
Synonyms: 4932415G16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 271036
VEGA: 12
Homologene: 81904
Fastkd3
Name: FAST kinase domains 3
Synonyms: 2310010B21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69577
VEGA: 13
Homologene: 11457
Selenoo
Name: selenoprotein O
Synonyms: 1300018J18Rik, Selo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223776
Homologene: 69439
Or1e16
Name: olfactory receptor family 1 subfamily E member 16
Synonyms: MOR135-13, GA_x6K02T2P1NL-3556334-3555390, I54, Olfr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258923
Homologene: 115482
Oosp2
Name: oocyte secreted protein 2
Synonyms: LOC225922, Tmem122, Plac1l
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225922
Homologene: 52157
Vmn1r65
Name: vomeronasal 1 receptor 65
Synonyms: V3R6, V1rd6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81013
Homologene: 110799
Ccin
Name: calicin
Synonyms: 4933417A14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 442829
HGNC: HGNC:1568
Homologene: 4306
Dnah7c
Name: dynein, axonemal, heavy chain 7C
Synonyms: Dnahc7c
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100101919
Homologene: 41287
Map10
Name: microtubule-associated protein 10
Synonyms: 4933403G14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74393
Homologene: 10416
Lipf
Name: lipase, gastric
Synonyms: 2310051B21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67717
HGNC: HGNC:6622
Homologene: 68139
Imp4
Name: IMP4, U3 small nucleolar ribonucleoprotein
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27993
Homologene: 68891
H1f4
Name: H1.4 linker histone, cluster member
Synonyms: H1s-4, H1e, H1var2, H1-4, H1f4, Hist1h1e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 50709
HGNC: HGNC:4718
Homologene: 137314
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Diet1, Gm13318, Gm13364
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Raet1e
Name: retinoic acid early transcript 1E
Synonyms: Rae-1 epsilon
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 379043
Homologene: 134115
Lsm7
Name: LSM7 homolog, U6 small nuclear RNA and mRNA degradation associated
Synonyms: 0910001B06Rik, 1110033F18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66094
VEGA: 10
Homologene: 6781
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,443,456 bp
  • G to T, chromosome 1 at 34,721,903 bp
  • A to T, chromosome 1 at 46,457,258 bp
  • T to A, chromosome 1 at 67,157,713 bp
  • T to A, chromosome 1 at 133,731,907 bp
  • T to C, chromosome 1 at 140,163,131 bp
  • A to T, chromosome 1 at 157,552,939 bp
  • T to A, chromosome 2 at 15,845,326 bp
  • T to A, chromosome 2 at 111,814,357 bp
  • A to G, chromosome 3 at 51,442,821 bp
  • T to C, chromosome 3 at 88,985,019 bp
  • A to G, chromosome 3 at 101,862,919 bp
  • G to A, chromosome 4 at 43,985,354 bp
  • T to A, chromosome 5 at 44,044,408 bp
  • G to T, chromosome 5 at 48,390,941 bp
  • T to A, chromosome 5 at 87,081,518 bp
  • A to T, chromosome 5 at 151,095,500 bp
  • C to A, chromosome 6 at 38,295,280 bp
  • T to A, chromosome 6 at 55,967,681 bp
  • T to C, chromosome 6 at 125,165,298 bp
  • T to C, chromosome 7 at 4,242,134 bp
  • A to T, chromosome 7 at 4,677,712 bp
  • A to G, chromosome 7 at 6,008,869 bp
  • T to A, chromosome 7 at 55,167,224 bp
  • A to G, chromosome 7 at 67,734,905 bp
  • T to G, chromosome 7 at 126,978,325 bp
  • C to T, chromosome 7 at 128,750,203 bp
  • T to C, chromosome 8 at 125,672,466 bp
  • C to G, chromosome 8 at 127,064,327 bp
  • A to T, chromosome 9 at 75,255,905 bp
  • T to A, chromosome 10 at 5,823,834 bp
  • A to G, chromosome 10 at 22,182,091 bp
  • T to C, chromosome 10 at 80,852,908 bp
  • AAGCAGCAGCAGCAGCAGCAGCAG to AAGCAGCAGCAGCAGCAGCAG, chromosome 11 at 70,607,040 bp
  • AGCGGTCGTAGGC to AGC, chromosome 11 at 73,395,654 bp
  • A to G, chromosome 11 at 78,018,069 bp
  • T to C, chromosome 11 at 102,061,634 bp
  • A to G, chromosome 11 at 119,243,072 bp
  • C to A, chromosome 12 at 17,307,500 bp
  • T to C, chromosome 12 at 98,771,373 bp
  • A to G, chromosome 12 at 101,575,832 bp
  • A to T, chromosome 12 at 101,651,201 bp
  • A to G, chromosome 13 at 23,622,313 bp
  • T to A, chromosome 13 at 68,583,610 bp
  • A to C, chromosome 13 at 96,609,800 bp
  • A to T, chromosome 15 at 58,108,563 bp
  • A to G, chromosome 15 at 89,099,343 bp
  • G to A, chromosome 17 at 33,104,961 bp
  • T to C, chromosome 17 at 34,241,218 bp
  • T to A, chromosome 17 at 55,482,981 bp
  • T to A, chromosome 17 at 74,615,283 bp
  • T to C, chromosome 18 at 31,689,406 bp
  • T to A, chromosome 18 at 36,930,598 bp
  • A to G, chromosome 18 at 37,762,548 bp
  • T to A, chromosome 18 at 61,132,522 bp
  • A to G, chromosome 19 at 11,651,515 bp
  • T to C, chromosome 19 at 33,964,889 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6034 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044206-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.