Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6054Btlr/Mmmh
Stock Number:
044222-MU
Citation ID:
RRID:MMRRC_044222-MU
Other Names:
R6054 (G1)
Major Collection:

Strain Information

Pzp2
Name: PZP alpha-2-macroglobulin like 2
Synonyms: Pzp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Dhx35
Name: DEAH-box helicase 35
Synonyms: Ddx35, 1200009D07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71715
Homologene: 6406
Wdr48
Name: WD repeat domain 48
Synonyms: 8430408H12Rik, Uaf1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67561
VEGA: 9
Homologene: 10830
Idh3a
Name: isocitrate dehydrogenase 3 (NAD+) alpha
Synonyms: 1500012E04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67834
VEGA: 9
HGNC: HGNC:5384
Homologene: 4037
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Opa1
Name: OPA1, mitochondrial dynamin like GTPase
Synonyms: 1200011N24Rik, lilr3, optic atrophy 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74143
HGNC: HGNC:8140
Homologene: 14618
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 6,249,834 bp
  • A to G, chromosome 2 at 87,508,659 bp
  • C to A, chromosome 2 at 91,649,291 bp
  • T to A, chromosome 2 at 158,818,299 bp
  • A to T, chromosome 3 at 83,346,236 bp
  • GTCATCATCATCATCATC to GTCATCATCATCATCATCATC, chromosome 3 at 89,997,940 bp
  • A to G, chromosome 3 at 108,406,963 bp
  • A to G, chromosome 3 at 138,445,375 bp
  • G to A, chromosome 4 at 130,061,722 bp
  • A to G, chromosome 4 at 147,865,678 bp
  • A to G, chromosome 4 at 154,263,179 bp
  • T to C, chromosome 5 at 30,123,684 bp
  • T to C, chromosome 5 at 33,882,161 bp
  • T to A, chromosome 5 at 108,848,260 bp
  • G to A, chromosome 6 at 8,083,748 bp
  • T to C, chromosome 6 at 128,513,764 bp
  • C to A, chromosome 7 at 4,145,523 bp
  • T to A, chromosome 7 at 43,355,006 bp
  • A to G, chromosome 7 at 64,268,702 bp
  • T to C, chromosome 7 at 72,259,103 bp
  • A to G, chromosome 7 at 103,881,826 bp
  • T to C, chromosome 7 at 118,408,133 bp
  • C to T, chromosome 7 at 127,752,509 bp
  • T to G, chromosome 8 at 84,556,785 bp
  • TCAGCAGCAGCAGCAGCAGC to TCAGCAGCAGCAGCAGC, chromosome 9 at 13,621,399 bp
  • G to A, chromosome 9 at 45,002,161 bp
  • T to C, chromosome 9 at 53,459,873 bp
  • T to C, chromosome 9 at 54,586,545 bp
  • A to G, chromosome 9 at 69,378,802 bp
  • A to G, chromosome 9 at 119,907,777 bp
  • T to A, chromosome 10 at 39,824,150 bp
  • T to C, chromosome 10 at 56,162,208 bp
  • G to A, chromosome 10 at 81,199,634 bp
  • T to C, chromosome 10 at 107,582,358 bp
  • A to T, chromosome 11 at 26,486,975 bp
  • G to A, chromosome 11 at 50,984,804 bp
  • T to C, chromosome 11 at 59,758,425 bp
  • G to A, chromosome 11 at 95,749,863 bp
  • A to T, chromosome 11 at 99,772,648 bp
  • C to T, chromosome 11 at 101,039,889 bp
  • A to G, chromosome 11 at 108,395,975 bp
  • A to C, chromosome 12 at 81,420,054 bp
  • T to A, chromosome 12 at 108,274,769 bp
  • G to A, chromosome 13 at 38,167,609 bp
  • A to G, chromosome 13 at 59,715,650 bp
  • T to A, chromosome 13 at 73,940,741 bp
  • C to T, chromosome 14 at 54,921,157 bp
  • T to A, chromosome 14 at 68,642,152 bp
  • C to A, chromosome 15 at 83,651,676 bp
  • T to C, chromosome 16 at 4,835,865 bp
  • A to T, chromosome 16 at 22,953,662 bp
  • T to G, chromosome 16 at 29,615,134 bp
  • C to T, chromosome 17 at 53,398,999 bp
  • T to C, chromosome 17 at 56,294,420 bp
  • A to G, chromosome 18 at 36,940,804 bp
  • T to G, chromosome 18 at 37,321,080 bp
  • A to G, chromosome 18 at 41,986,678 bp
  • C to T, chromosome 18 at 47,283,403 bp
  • T to G, chromosome 18 at 49,857,386 bp
  • A to T, chromosome 19 at 4,825,865 bp
  • A to T, chromosome 19 at 42,770,778 bp
  • A to G, chromosome 19 at 45,776,132 bp
  • A to G, chromosome 19 at 47,680,420 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6054 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044222-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.