Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6118Btlr
Stock Number:
044267-MU
Citation ID:
RRID:MMRRC_044267-MU
Other Names:
R6118 (G1)
Major Collection:

Strain Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Del1, Col2a-1, Col2a, Col2, M100856, Rgsc856, Lpk, M100413, Rgsc413
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66797
Homologene: 69159
Epb41l1
Name: erythrocyte membrane protein band 4.1 like 1
Synonyms: 4.1N, Epb4.1l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13821
HGNC: HGNC:3378
Homologene: 8126
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Hap1
Name: huntingtin-associated protein 1
Synonyms: HAP-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15114
HGNC: HGNC:4812
Homologene: 2935
Tpp2
Name: tripeptidyl peptidase II
Synonyms: TppII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22019
Homologene: 2471
Csde1
Name: cold shock domain containing E1, RNA binding
Synonyms: unr, D3Jfr1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229663
Homologene: 5179
Als2
Name: alsin Rho guanine nucleotide exchange factor
Synonyms: Als2cr6, 3222402C23Rik, 9430073A21Rik, Alsin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74018
HGNC: HGNC:443
Homologene: 23264
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Slc38a10
Name: solute carrier family 38, member 10
Synonyms: 1810073N04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72055
Homologene: 41556
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Arel1
Name: apoptosis resistant E3 ubiquitin protein ligase 1
Synonyms: 1110018G07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68497
Homologene: 8885
Mcm2
Name: minichromosome maintenance complex component 2
Synonyms: CDCL1, BM28, Mcmd2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17216
HGNC: HGNC:6944
Homologene: 3325
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Tbc1d1
Name: TBC1 domain family, member 1
Synonyms: 1110062G02Rik, Nob1, Nobq1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57915
Homologene: 56856
C1qtnf6
Name: C1q and tumor necrosis factor related protein 6
Synonyms: 2810036M19Rik, CTRP6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72709
Homologene: 12481
Pold3
Name: polymerase (DNA-directed), delta 3, accessory subunit
Synonyms: P68, P66, 2410142G14Rik, C85233, GC12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67967
Homologene: 38202
Atad1
Name: ATPase family, AAA domain containing 1
Synonyms: 4921525H23Rik, Thorase
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67979
VEGA: 19
Homologene: 5960
Memo1
Name: mediator of cell motility 1
Synonyms: D930048L02Rik, 0610016J10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76890
VEGA: 17
Homologene: 6272
Antxr2
Name: anthrax toxin receptor 2
Synonyms: cI-35, CMG-2, CMG2, 2310046B19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71914
Homologene: 43236
Chtf18
Name: CTF18, chromosome transmission fidelity factor 18
Synonyms: 6030457M03Rik, CTF18
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 214901
Homologene: 32532
Slco3a1
Name: solute carrier organic anion transporter family, member 3a1
Synonyms: MJAM, OATP-D, 5830414C08Rik, Anr1, Slc21a11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108116
Homologene: 40862
Rfx6
Name: regulatory factor X, 6
Synonyms: 4930572O07Rik, Rfxdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320995
Homologene: 18318
Adgb
Name: androglobin
Synonyms: 9130014G24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215772
Homologene: 100289
Rfc4
Name: replication factor C (activator 1) 4
Synonyms: RFC37, A1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106344
HGNC: HGNC:9972
Homologene: 6288
B3galnt2
Name: UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2
Synonyms: A930105D20Rik, D230016N13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 97884
VEGA: 13
Homologene: 17595
Slco1b2
Name: solute carrier organic anion transporter family, member 1b2
Synonyms: mlst-1, Slc21a6, Slc21a10, Oatp1b2, 7330442B20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28253
Homologene: 75119
Ceacam20
Name: CEA cell adhesion molecule 20
Synonyms: 9130012D09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71601
Homologene: 19010
Gabbr2
Name: gamma-aminobutyric acid type B receptor subunit 2
Synonyms: Gababr2, LOC242425, Gpr51, GB2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242425
HGNC: HGNC:4507
Homologene: 55902
Trim30c
Name: tripartite motif-containing 30C
Synonyms: Trim30-2, Gm5598
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434219
Bag6
Name: BCL2-associated athanogene 6
Synonyms: D17H6S52E, 2410045D21Rik, G3, Scythe, Bat3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224727
Homologene: 3409
Or4c107
Name: olfactory receptor family 4 subfamily C member 107
Synonyms: GA_x6K02T2Q125-50437014-50437949, MOR233-17, MOR233-20, Olfr1212
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258241
Homologene: 66154
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: VKIND, very-kind, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76484
Homologene: 45138
H2bc18
Name: H2B clustered histone 18
Synonyms: H2b-616, Hist2h2bb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 319189
Homologene: 136264
Or8k35
Name: olfactory receptor family 8 subfamily K member 35
Synonyms: GA_x6K02T2Q125-48079993-48079157, MOR192-4_p, Olfr1082
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404473
Homologene: 104285
Skint4
Name: selection and upkeep of intraepithelial T cells 4
Synonyms: 9530098N22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320640
Zfp827
Name: zinc finger protein 827
Synonyms: 2810449M09Rik, D630040G17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 622675
Homologene: 45622
Mptx2
Name: mucosal pentraxin 2
Synonyms: Gm11062
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100504232
Homologene: 134535
Meox2
Name: mesenchyme homeobox 2
Synonyms: Gax, Mox-2, Mox2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17286
HGNC: HGNC:7014
Homologene: 4330
Fam53c
Name: family with sequence similarity 53, member C
Synonyms: 2810012G03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66306
VEGA: 18
HGNC: HGNC:1336
Homologene: 9586
Rbm12b2
Name: RNA binding motif protein 12 B2
Synonyms: C430048L16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77604
Homologene: 28658
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 43,940,146 bp
  • A to T, chromosome 1 at 59,203,069 bp
  • A to G, chromosome 1 at 75,492,078 bp
  • G to A, chromosome 1 at 173,274,847 bp
  • T to A, chromosome 2 at 86,594,414 bp
  • T to A, chromosome 2 at 88,959,118 bp
  • G to A, chromosome 2 at 156,522,477 bp
  • T to A, chromosome 3 at 96,269,951 bp
  • T to A, chromosome 3 at 103,054,754 bp
  • T to C, chromosome 4 at 12,095,135 bp
  • C to T, chromosome 4 at 46,736,459 bp
  • T to A, chromosome 4 at 112,119,822 bp
  • C to T, chromosome 5 at 64,284,037 bp
  • T to A, chromosome 5 at 97,949,201 bp
  • T to A, chromosome 6 at 47,193,077 bp
  • C to T, chromosome 6 at 88,887,836 bp
  • A to G, chromosome 6 at 141,657,510 bp
  • T to C, chromosome 7 at 19,971,729 bp
  • C to T, chromosome 7 at 74,318,506 bp
  • A to G, chromosome 7 at 100,096,407 bp
  • G to T, chromosome 7 at 104,382,081 bp
  • A to G, chromosome 7 at 139,923,802 bp
  • G to T, chromosome 8 at 79,076,438 bp
  • T to G, chromosome 10 at 10,431,291 bp
  • T to A, chromosome 10 at 51,711,866 bp
  • A to G, chromosome 10 at 67,240,012 bp
  • A to G, chromosome 10 at 69,994,401 bp
  • G to T, chromosome 11 at 100,355,794 bp
  • T to C, chromosome 11 at 120,132,843 bp
  • GCACCACCACCACCACCACCA to GCACCACCACCACCACCA, chromosome 12 at 37,109,031 bp
  • A to G, chromosome 12 at 84,941,939 bp
  • C to T, chromosome 13 at 3,581,891 bp
  • C to A, chromosome 13 at 11,792,689 bp
  • A to G, chromosome 13 at 13,991,509 bp
  • T to C, chromosome 15 at 78,525,395 bp
  • T to C, chromosome 15 at 97,998,567 bp
  • A to T, chromosome 16 at 23,120,943 bp
  • C to T, chromosome 17 at 25,719,159 bp
  • T to A, chromosome 17 at 35,143,624 bp
  • T to C, chromosome 17 at 74,202,307 bp
  • A to C, chromosome 18 at 34,768,690 bp
  • C to T, chromosome 19 at 32,687,297 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6118 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044267-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.