Strain Name:
C57BL/6J-MtgxR6187Btlr
Stock Number:
044327-MU
Citation ID:
RRID:MMRRC_044327-MU
Other Names:
R6187 (G1)
Major Collection:

Gene Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Del1, Lpk, M100856, Col2, Rgsc856, Col2a, Col2a-1, M100413, Rgsc413
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
Nfatc2
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2
Synonyms: NFAT1-D, NFAT1, NFATp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 18019
HGNC: HGNC:7776
Homologene: 7861
Otx1
Name: orthodenticle homeobox 1
Synonyms: A730044F23Rik, jv
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 18423
HGNC: HGNC:8521
Homologene: 7875
Rpa1
Name: replication protein A1
Synonyms: Rpa, RP-A, 5031405K23Rik, 70kDa, RF-A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 68275
Homologene: 2208
Oxr1
Name: oxidation resistance 1
Synonyms: C7, C7B, 2210416C20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 170719
VEGA: 15
Homologene: 24993
Yes1
Name: YES proto-oncogene 1, Src family tyrosine kinase
Synonyms: Yes
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 22612
Homologene: 55900
Gpr1
Name: G protein-coupled receptor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 241070
HGNC: HGNC:4463
Homologene: 21094
Tnfaip1
Name: tumor necrosis factor, alpha-induced protein 1 (endothelial)
Synonyms: Bacurd2, Edp1, Edp-1, Tnfip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 21927
Homologene: 22519
Asah2
Name: N-acylsphingosine amidohydrolase 2
Synonyms: neutral/alkaline ceramidase
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 54447
VEGA: 19
Homologene: 10310
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 320528
VEGA: 9
Homologene: 41188
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Phr1, C130061D10Rik, Pam
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 105689
Homologene: 9005
Pard3
Name: par-3 family cell polarity regulator
Synonyms: Pard3a, PAR-3, Par3, ASIP, D8Ertd580e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 93742
Homologene: 10489
Kif13b
Name: kinesin family member 13B
Synonyms: 5330429L19Rik, N-3 kinesin, GAKIN, C130021D12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 16554
VEGA: 14
Homologene: 9073
Zfr
Name: zinc finger RNA binding protein
Synonyms: C920030H05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 22763
Homologene: 8009
Eif2ak4
Name: eukaryotic translation initiation factor 2 alpha kinase 4
Synonyms: GCN2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 27103
Homologene: 40891
Smg1
Name: SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Synonyms: 5430435M13Rik, C130002K18Rik, 2610207I05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 233789
Homologene: 56697
Zfp407
Name: zinc finger protein 407
Synonyms: LOC240469, 6430585N13Rik, LOC381139
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 240476
Homologene: 86402
Afg3l2
Name: AFG3-like AAA ATPase 2
Synonyms: 2310036I02Rik, Emv66, par
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 69597
VEGA: 18
HGNC: HGNC:315
Homologene: 4947
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: Solo, 6720464I07Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 223435
VEGA: 15
Homologene: 20847
Myh14
Name: myosin, heavy polypeptide 14
Synonyms: 2400004E04Rik, NMHC II-C
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 71960
Homologene: 23480
Unc5b
Name: unc-5 netrin receptor B
Synonyms: Unc5h2, 6330415E02Rik, D10Bwg0792e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 107449
VEGA: 10
Homologene: 32538
Plxnb2
Name: plexin B2
Synonyms: 1110007H23Rik, Debt
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 140570
HGNC: HGNC:9104
Homologene: 66630
Minar1
Name: membrane integral NOTCH2 associated receptor 1
Synonyms: AF529169, DD1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 209743
Homologene: 17782
Gas1
Name: growth arrest specific 1
Synonyms: Gas-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 14451
HGNC: HGNC:4165
Homologene: 1548
Gemin2
Name: gem nuclear organelle associated protein 2
Synonyms: 1700012N19Rik, Sip1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 66603
Homologene: 37827
Atp6v1b1
Name: ATPase, H+ transporting, lysosomal V1 subunit B1
Synonyms: lysosomal 56/58kDa, Vpp3, Atp6b1, D630039P21Rik, D630030L16Rik, Vpp-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 110935
HGNC: HGNC:853
Homologene: 68198
Magel2
Name: melanoma antigen, family L, 2
Synonyms: Mage-l2, NDNL1, nM15, ns7
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 27385
HGNC: HGNC:6814
Homologene: 8460
Itfg1
Name: integrin alpha FG-GAP repeat containing 1
Synonyms: D8Wsu49e, 2310047C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 71927
Homologene: 12423
Bub1b
Name: BUB1B, mitotic checkpoint serine/threonine kinase
Synonyms: BUBR1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 12236
HGNC: HGNC:1149
Homologene: 933
Nupl1
Name: nucleoporin like 1
Synonyms: 1700017F11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 71844
VEGA: 14
Homologene: 40924
Tbk1
Name: TANK-binding kinase 1
Synonyms: 1200008B05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: Chemically Induced
NCBI: 56480
VEGA: 10
Homologene: 22742
Cyp4f18
Name: cytochrome P450, family 4, subfamily f, polypeptide 18
Synonyms: 1810054N16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 72054
HGNC: HGNC:2645
Homologene: 128623
Abca3
Name: ATP-binding cassette, sub-family A (ABC1), member 3
Synonyms: ABC-C, Abc3, 1810036E22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 27410
HGNC: HGNC:33
Homologene: 37437
Abca13
Name: ATP-binding cassette, sub-family A (ABC1), member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 268379
Homologene: 27991
Adamts4
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4
Synonyms: ADAM-TS4, aggrecanase-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 240913
HGNC: HGNC:220
Homologene: 36169
Ppp2cb
Name: protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform
Synonyms: PP2Ac, D8Ertd766e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: Chemically Induced
NCBI: 19053
HGNC: HGNC:9300
Homologene: 37889
Adamts6
Name: a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6
Synonyms: A930019D11Rik, ADAM-TS6, b2b2228Clo, b2b1879.1Clo, b2b2029Clo, b2b2182Clo, b2b2187.1Clo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 108154
VEGA: 13
HGNC: HGNC:222
Homologene: 82573
Ttn
Name: titin
Synonyms: shru, connectin, mdm, 2310057K23Rik, D330041I19Rik, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, L56, 2310074I15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 22138
Homologene: 130650
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 545370
Homologene: 23741
Kidins220
Name: kinase D-interacting substrate 220
Synonyms: 3110039L19Rik, C330002I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
Alteration at locus: Chemically Induced
NCBI: 77480
VEGA: 12
Homologene: 14254
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 1110021D17Rik, 4833413O10Rik, Polydom, D430029O09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 64817
Homologene: 23386
Olfr835
Name: olfactory receptor 835
Synonyms: MOR150-3, GA_x6K02T2PVTD-12771995-12772930
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 257872
Homologene: 133702
5430419D17Rik
Name: RIKEN cDNA 5430419D17 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 71395
Homologene: 138430
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 241516
Homologene: 110349
Ciz1
Name: CDKN1A interacting zinc finger protein 1
Synonyms: 2900056O04Rik, 0610038H21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 68379
Homologene: 8112
Gstk1
Name: glutathione S-transferase kappa 1
Synonyms: DsbA-L, 0610025I19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 76263
Homologene: 41075
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: mG145, Rp1h, oxygen-regulated protein 1, Orp1, Dcdc3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 19888
Homologene: 4564
Fbxw14
Name: F-box and WD-40 domain protein 14
Synonyms: Fbxo12, E330009N23Rik, Fbx12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 50757
Homologene: 110776
Gria1
Name: glutamate receptor, ionotropic, AMPA1 (alpha 1)
Synonyms: 2900051M01Rik, GluR-A, Glur-1, Glr1, GluA1, GluRA, Glr-1, HIPA1, GluR1, Glur1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 14799
HGNC: HGNC:4571
Homologene: 20226
Olfr1383
Name: olfactory receptor 1383
Synonyms: GA_x6K02T2QP88-5912627-5911692, MOR256-56
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: Chemically Induced
NCBI: 404337
Homologene: 105344
Adam2
Name: a disintegrin and metallopeptidase domain 2
Synonyms: fertilin beta, Ftnb, Ph30-beta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 11495
VEGA: 14
HGNC: HGNC:198
Homologene: 1127
Disp2
Name: dispatched RND tramsporter family member 2
Synonyms: DispB, B230210L08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 214240
Homologene: 24916
Faxc
Name: failed axon connections homolog
Synonyms: 6230409E13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 76132
Homologene: 32781
Zfp518a
Name: zinc finger protein 518A
Synonyms: 2810401C22Rik, Zfp518, 6330417C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 72672
VEGA: 19
Homologene: 19378
Olfr1115
Name: olfactory receptor 1115
Synonyms: MOR273-4P, GA_x6K02T2Q125-48736906-48737886, Olfr1530-ps1, MOR264-20, MOR273-4P
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 258294
Homologene: 27114
Axdnd1
Name: axonemal dynein light chain domain containing 1
Synonyms: 9430070O13Rik, LOC381304
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 77352
Homologene: 52328
Vmn2r91
Name: vomeronasal 2, receptor 91
Synonyms: EG665210
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 665210
Homologene: 115024
Pcdhb14
Name: protocadherin beta 14
Synonyms: PcdhbN, 2210006M07Rik, Pcdhb17
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 93885
Homologene: 70876
Pcdhb7
Name: protocadherin beta 7
Synonyms: PcdhbG, Pcdhb4B
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 93878
Homologene: 87123
Prr5
Name: proline rich 5 (renal)
Synonyms: Protor-1, C030017C09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 109270
Homologene: 17132
Vcpip1
Name: valosin containing protein (p97)/p47 complex interacting protein 1
Synonyms: Vcip135, 5730538E15Rik, 5730421J18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Chemically Induced
NCBI: 70675
Homologene: 11814
Cenpq
Name: centromere protein Q
Synonyms: 2610528M18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 83815
Homologene: 49525
Fpr1
Name: formyl peptide receptor 1
Synonyms: fMLF-R, FPR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 14293
HGNC: HGNC:3826
Homologene: 20466
Sry
Name: sex determining region of Chr Y
Synonyms: Tdf, Tdy
Type: Gene
Species: Mus musculus (mouse)
Chromosome: Y
Alteration at locus: Chemically Induced
NCBI: 21674
Ugt2b35
Name: UDP glucuronosyltransferase 2 family, polypeptide B35
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: Chemically Induced
NCBI: 243085
Homologene: 128251
Olfr469
Name: olfactory receptor 469
Synonyms: GA_x6K02T2PBJ9-10152980-10152036, MOR204-21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 258418
Homologene: 44979
Mlip
Name: muscular LMNA-interacting protein
Synonyms: cardiac ISL1-interacting protein, CIP, 2310046A06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Alteration at locus: Chemically Induced
NCBI: 69642
Homologene: 90445
Mab21l2
Name: mab-21-like 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 23937
HGNC: HGNC:6758
Homologene: 7824
Alpk1
Name: alpha-kinase 1
Synonyms: 8430410J10Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: Chemically Induced
NCBI: 71481
Homologene: 11849
Ankrd29
Name: ankyrin repeat domain 29
Synonyms: G630054C21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Alteration at locus: Chemically Induced
NCBI: 225187
Homologene: 17839
Tas2r106
Name: taste receptor, type 2, member 106
Synonyms: T2R06, Tas2r6, mGR06, mt2r44
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 387341
Homologene: 130071
Mdfic
Name: MyoD family inhibitor domain containing
Synonyms: Kdt1, clone 1.5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: Chemically Induced
NCBI: 16543
Homologene: 18404
Uap1l1
Name: UDP-N-acteylglucosamine pyrophosphorylase 1-like 1
Synonyms: 5730445F03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 227620
Homologene: 71313
Cyp2c68
Name: cytochrome P450, family 2, subfamily c, polypeptide 68
Synonyms: 9030012A22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Chemically Induced
NCBI: 433247
Homologene: 74936
Padi1
Name: peptidyl arginine deiminase, type I
Synonyms: Pdi1, Pad type 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
Alteration at locus: Chemically Induced
NCBI: 18599
Homologene: 7881
Tekt4
Name: tektin 4
Synonyms: 1700010L19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 71840
Homologene: 25745
Olfr724
Name: olfactory receptor 724
Synonyms: GA_x6K02T2PMLR-5645801-5644872, MOR247-2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Chemically Induced
NCBI: 258485
Homologene: 71986
Gm8444
Name: predicted gene 8444
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Chemically Induced
NCBI: 667073
VEGA: 15
Ak1
Name: adenylate kinase 1
Synonyms: B430205N08Rik, Ak-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: Chemically Induced
NCBI: 11636
HGNC: HGNC:361
Homologene: 20135
Olfr120
Name: olfactory receptor 120
Synonyms: MOR263-3, GA_x6K02T2PSCP-2184981-2185946
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Chemically Induced
NCBI: 258624
Homologene: 110622
Olfr535
Name: olfactory receptor 535
Synonyms: MOR253-7, GA_x6K02T2PBJ9-42641642-42642574
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Chemically Induced
NCBI: 258956
Homologene: 138320
Gm21370
Name: predicted gene, 21370
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
Alteration at locus: Chemically Induced
NCBI: 100861977
VEGA: 13
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 4,349,869 bp
  • T to C, chromosome 1 at 9,724,780 bp
  • T to C, chromosome 1 at 63,183,275 bp
  • T to C, chromosome 1 at 150,630,728 bp
  • T to A, chromosome 1 at 156,365,612 bp
  • C to T, chromosome 1 at 171,250,993 bp
  • C to T, chromosome 2 at 25,362,729 bp
  • T to A, chromosome 2 at 32,370,051 bp
  • G to A, chromosome 2 at 32,633,477 bp
  • T to A, chromosome 2 at 76,944,437 bp
  • T to C, chromosome 2 at 82,982,454 bp
  • T to A, chromosome 2 at 87,252,698 bp
  • C to T, chromosome 2 at 118,457,157 bp
  • T to G, chromosome 2 at 118,631,000 bp
  • A to G, chromosome 2 at 118,792,143 bp
  • T to A, chromosome 2 at 168,480,238 bp
  • T to C, chromosome 3 at 86,547,258 bp
  • T to C, chromosome 3 at 127,673,342 bp
  • A to G, chromosome 4 at 21,958,445 bp
  • C to T, chromosome 4 at 58,072,872 bp
  • C to T, chromosome 4 at 140,826,965 bp
  • A to G, chromosome 5 at 32,645,041 bp
  • T to C, chromosome 5 at 87,007,322 bp
  • T to C, chromosome 6 at 15,721,197 bp
  • G to A, chromosome 6 at 42,249,860 bp
  • A to T, chromosome 6 at 83,752,395 bp
  • A to G, chromosome 6 at 131,678,210 bp
  • G to A, chromosome 7 at 44,627,033 bp
  • A to G, chromosome 7 at 62,377,641 bp
  • A to T, chromosome 7 at 107,822,574 bp
  • A to T, chromosome 7 at 118,189,163 bp
  • G to A, chromosome 7 at 131,270,599 bp
  • A to G, chromosome 7 at 140,492,616 bp
  • T to C, chromosome 8 at 33,615,474 bp
  • C to A, chromosome 8 at 71,993,186 bp
  • A to C, chromosome 8 at 85,836,465 bp
  • T to C, chromosome 8 at 127,073,273 bp
  • A to C, chromosome 9 at 19,035,393 bp
  • C to T, chromosome 9 at 67,915,657 bp
  • G to A, chromosome 9 at 77,230,482 bp
  • A to G, chromosome 9 at 89,591,167 bp
  • A to G, chromosome 9 at 109,276,264 bp
  • T to C, chromosome 10 at 60,772,224 bp
  • T to C, chromosome 10 at 121,584,243 bp
  • T to A, chromosome 11 at 9,309,085 bp
  • A to T, chromosome 11 at 21,999,406 bp
  • G to T, chromosome 11 at 49,523,511 bp
  • A to G, chromosome 11 at 57,238,110 bp
  • C to G, chromosome 11 at 75,310,236 bp
  • T to A, chromosome 11 at 78,527,546 bp
  • A to G, chromosome 12 at 25,051,308 bp
  • A to G, chromosome 12 at 59,013,585 bp
  • G to T, chromosome 13 at 60,176,372 bp
  • C to T, chromosome 13 at 104,297,425 bp
  • T to C, chromosome 13 at 120,026,867 bp
  • A to G, chromosome 14 at 49,961,069 bp
  • T to C, chromosome 14 at 60,240,807 bp
  • A to C, chromosome 14 at 64,736,215 bp
  • A to T, chromosome 14 at 66,068,619 bp
  • A to G, chromosome 14 at 103,147,017 bp
  • AGCAGCAGCAGCAGCTGCTGCTGCAGCAGCA to AGCAGCAGCA, chromosome 15 at 12,146,231 bp
  • C to T, chromosome 15 at 27,743,952 bp
  • A to G, chromosome 15 at 41,825,919 bp
  • T to C, chromosome 15 at 81,843,606 bp
  • C to T, chromosome 15 at 84,693,772 bp
  • C to T, chromosome 15 at 89,167,258 bp
  • G to T, chromosome 15 at 97,988,790 bp
  • G to T, chromosome 17 at 17,876,928 bp
  • T to C, chromosome 17 at 18,106,626 bp
  • A to G, chromosome 17 at 24,408,167 bp
  • G to C, chromosome 17 at 25,472,223 bp
  • T to C, chromosome 17 at 37,726,141 bp
  • T to A, chromosome 17 at 40,927,198 bp
  • A to C, chromosome 18 at 12,279,690 bp
  • A to G, chromosome 18 at 37,342,569 bp
  • A to T, chromosome 18 at 37,448,444 bp
  • G to T, chromosome 18 at 67,421,259 bp
  • A to T, chromosome 18 at 84,559,009 bp
  • A to T, chromosome 19 at 32,024,867 bp
  • A to T, chromosome 19 at 39,741,008 bp
  • G to A, chromosome 19 at 40,915,446 bp
  • C to G, chromosome Y at 2,662,975 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6187 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
044327-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter1; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

3 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.