Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6187Btlr/Mmmh
Stock Number:
044327-MU
Citation ID:
RRID:MMRRC_044327-MU
Other Names:
R6187 (G1)
Major Collection:

Strain Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Del1, Col2a-1, Col2a, Col2, M100856, Rgsc856, Lpk, M100413, Rgsc413
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
Nfatc2
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2
Synonyms: NFAT1, NFATp, NFAT1-D
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18019
HGNC: HGNC:7776
Homologene: 7861
Otx1
Name: orthodenticle homeobox 1
Synonyms: A730044F23Rik, jv
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18423
HGNC: HGNC:8521
Homologene: 7875
Rpa1
Name: replication protein A1
Synonyms: Rpa, RF-A, RP-A, 5031405K23Rik, 70kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68275
Homologene: 2208
Oxr1
Name: oxidation resistance 1
Synonyms: C7B, C7, 2210416C20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170719
VEGA: 15
Homologene: 24993
Yes1
Name: YES proto-oncogene 1, Src family tyrosine kinase
Synonyms: Yes
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22612
Homologene: 55900
Cmklr2
Name: chemerin chemokine-like receptor 2
Synonyms: Gpr1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241070
HGNC: HGNC:4463
Homologene: 21094
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 4,349,869 bp
  • T to C, chromosome 1 at 9,724,780 bp
  • T to C, chromosome 1 at 63,183,275 bp
  • T to C, chromosome 1 at 150,630,728 bp
  • T to A, chromosome 1 at 156,365,612 bp
  • C to T, chromosome 1 at 171,250,993 bp
  • C to T, chromosome 2 at 25,362,729 bp
  • T to A, chromosome 2 at 32,370,051 bp
  • G to A, chromosome 2 at 32,633,477 bp
  • T to A, chromosome 2 at 76,944,437 bp
  • T to C, chromosome 2 at 82,982,454 bp
  • T to A, chromosome 2 at 87,252,698 bp
  • C to T, chromosome 2 at 118,457,157 bp
  • T to G, chromosome 2 at 118,631,000 bp
  • A to G, chromosome 2 at 118,792,143 bp
  • T to A, chromosome 2 at 168,480,238 bp
  • T to C, chromosome 3 at 86,547,258 bp
  • T to C, chromosome 3 at 127,673,342 bp
  • A to G, chromosome 4 at 21,958,445 bp
  • C to T, chromosome 4 at 58,072,872 bp
  • C to T, chromosome 4 at 140,826,965 bp
  • A to G, chromosome 5 at 32,645,041 bp
  • T to C, chromosome 5 at 87,007,322 bp
  • T to C, chromosome 6 at 15,721,197 bp
  • G to A, chromosome 6 at 42,249,860 bp
  • A to T, chromosome 6 at 83,752,395 bp
  • A to G, chromosome 6 at 131,678,210 bp
  • G to A, chromosome 7 at 44,627,033 bp
  • A to G, chromosome 7 at 62,377,641 bp
  • A to T, chromosome 7 at 107,822,574 bp
  • A to T, chromosome 7 at 118,189,163 bp
  • G to A, chromosome 7 at 131,270,599 bp
  • A to G, chromosome 7 at 140,492,616 bp
  • T to C, chromosome 8 at 33,615,474 bp
  • C to A, chromosome 8 at 71,993,186 bp
  • A to C, chromosome 8 at 85,836,465 bp
  • T to C, chromosome 8 at 127,073,273 bp
  • A to C, chromosome 9 at 19,035,393 bp
  • C to T, chromosome 9 at 67,915,657 bp
  • G to A, chromosome 9 at 77,230,482 bp
  • A to G, chromosome 9 at 89,591,167 bp
  • A to G, chromosome 9 at 109,276,264 bp
  • T to C, chromosome 10 at 60,772,224 bp
  • T to C, chromosome 10 at 121,584,243 bp
  • T to A, chromosome 11 at 9,309,085 bp
  • A to T, chromosome 11 at 21,999,406 bp
  • G to T, chromosome 11 at 49,523,511 bp
  • A to G, chromosome 11 at 57,238,110 bp
  • C to G, chromosome 11 at 75,310,236 bp
  • T to A, chromosome 11 at 78,527,546 bp
  • A to G, chromosome 12 at 25,051,308 bp
  • A to G, chromosome 12 at 59,013,585 bp
  • G to T, chromosome 13 at 60,176,372 bp
  • C to T, chromosome 13 at 104,297,425 bp
  • T to C, chromosome 13 at 120,026,867 bp
  • A to G, chromosome 14 at 49,961,069 bp
  • T to C, chromosome 14 at 60,240,807 bp
  • A to C, chromosome 14 at 64,736,215 bp
  • A to T, chromosome 14 at 66,068,619 bp
  • A to G, chromosome 14 at 103,147,017 bp
  • AGCAGCAGCAGCAGCTGCTGCTGCAGCAGCA to AGCAGCAGCA, chromosome 15 at 12,146,231 bp
  • C to T, chromosome 15 at 27,743,952 bp
  • A to G, chromosome 15 at 41,825,919 bp
  • T to C, chromosome 15 at 81,843,606 bp
  • C to T, chromosome 15 at 84,693,772 bp
  • C to T, chromosome 15 at 89,167,258 bp
  • G to T, chromosome 15 at 97,988,790 bp
  • G to T, chromosome 17 at 17,876,928 bp
  • T to C, chromosome 17 at 18,106,626 bp
  • A to G, chromosome 17 at 24,408,167 bp
  • G to C, chromosome 17 at 25,472,223 bp
  • T to C, chromosome 17 at 37,726,141 bp
  • T to A, chromosome 17 at 40,927,198 bp
  • A to C, chromosome 18 at 12,279,690 bp
  • A to G, chromosome 18 at 37,342,569 bp
  • A to T, chromosome 18 at 37,448,444 bp
  • G to T, chromosome 18 at 67,421,259 bp
  • A to T, chromosome 18 at 84,559,009 bp
  • A to T, chromosome 19 at 32,024,867 bp
  • A to T, chromosome 19 at 39,741,008 bp
  • G to A, chromosome 19 at 40,915,446 bp
  • C to G, chromosome Y at 2,662,975 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6187 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044327-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.