Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6200Btlr/Mmmh
Stock Number:
044340-MU
Citation ID:
RRID:MMRRC_044340-MU
Other Names:
R6200 (G1)
Major Collection:

Strain Information

Capzb
Name: capping actin protein of muscle Z-line subunit beta
Synonyms: CPbeta2, CPB2, CPbeta1, CPB1, 1700120C01Rik, Cappb1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12345
HGNC: HGNC:1491
Homologene: 3620
Luzp1
Name: leucine zipper protein 1
Synonyms: Luzp, 2700072H04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269593
Homologene: 11545
Prpf40a
Name: pre-mRNA processing factor 40A
Synonyms: FBP11, 2810012K09Rik, Fnbp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56194
Homologene: 6377
Fancc
Name: Fanconi anemia, complementation group C
Synonyms: Facc
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14088
HGNC: HGNC:3584
Homologene: 109
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Psip1
Name: PC4 and SFRS1 interacting protein 1
Synonyms: Psip2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 101739
HGNC: HGNC:9527
Homologene: 13242
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Dab1
Name: disabled 1
Synonyms: C630028C02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13131
HGNC: HGNC:2661
Homologene: 32084
Icam5
Name: intercellular adhesion molecule 5, telencephalin
Synonyms: CD50, Tlcn, TLN, Icam3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15898
VEGA: 9
HGNC: HGNC:5348
Homologene: 2447
Atraid
Name: all-trans retinoic acid induced differentiation factor
Synonyms: HSPC013, p18, 0610007C21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381629
Homologene: 15412
Zfp57
Name: zinc finger protein 57
Synonyms: G19
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22715
Homologene: 7603
Herpud2
Name: HERPUD family member 2
Synonyms: 5031400M07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 80517
VEGA: 9
Homologene: 10756
Ppp1r21
Name: protein phosphatase 1, regulatory subunit 21
Synonyms: 1110018J12Rik, Ccdc128, Klraq1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73825
Homologene: 44811
Tmco3
Name: transmembrane and coiled-coil domains 3
Synonyms: B230339H12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234076
Homologene: 32376
Nkpd1
Name: NTPase, KAP family P-loop domain containing 1
Synonyms: 2310015G09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69547
Homologene: 18876
Slc22a21
Name: solute carrier family 22 (organic cation transporter), member 21
Synonyms: Octn3, Slc22a9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56517
Homologene: 137336
Abca8a
Name: ATP-binding cassette, sub-family A member 8a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Pxdn
Name: peroxidasin
Synonyms: 2310075M15Rik, VPO1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69675
Homologene: 33907
Gpr158
Name: G protein-coupled receptor 158
Synonyms: 5330427M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241263
Homologene: 19381
Gm16432
Name: predicted gene 16432
Type: Gene
Species: Mouse
Chromosome: 1
Psd2
Name: pleckstrin and Sec7 domain containing 2
Synonyms: 6330404E20Rik, EFA6C
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74002
Homologene: 12522
Cfhr4
Name: complement factor H-related 4
Synonyms: Gm4788
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214403
HGNC: HGNC:4883
Tmc1
Name: transmembrane channel-like gene family 1
Synonyms: Bth, Beethoven, 4933416G09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13409
VEGA: 19
Homologene: 23670
Or5p58
Name: olfactory receptor family 5 subfamily P member 58
Synonyms: GA_x6K02T2PBJ9-10424354-10423383, MOR204-14, Olfr482
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258728
Homologene: 133604
Tspoap1
Name: TSPO associated protein 1
Synonyms: peripheral, Bzrap1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207777
Homologene: 37961
Tle2
Name: transducin-like enhancer of split 2
Synonyms: Grg2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21886
Homologene: 20693
Slc16a8
Name: solute carrier family 16 (monocarboxylic acid transporters), member 8
Synonyms: proton-coupled monocarboxylate transporter 3, Mct3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 57274
Homologene: 75006
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
G6pd2
Name: glucose-6-phosphate dehydrogenase 2
Synonyms: Gpd2, Gpd-2, G6pdx-ps1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14380
HGNC: HGNC:4057
Pabpc4l
Name: poly(A) binding protein, cytoplasmic 4-like
Synonyms: C330050A14Rik, EG241989
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241989
Homologene: 66336
Pcsk1
Name: proprotein convertase subtilisin/kexin type 1
Synonyms: PC3, prohormone convertase 1/3, Nec-1, Nec1, PC1, SPC3, Phpp-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18548
HGNC: HGNC:8743
Homologene: 379
Fcamr
Name: Fc receptor, IgA, IgM, high affinity
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 64435
Homologene: 12929
Smad9
Name: SMAD family member 9
Synonyms: Madh9, SMAD8B, SMAD8A, MADH6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 55994
HGNC: HGNC:6774
Homologene: 21198
Pcdhga7
Name: protocadherin gamma subfamily A, 7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93715
HGNC: HGNC:8705
Homologene: 36377
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 130,803,190 bp
  • T to A, chromosome 1 at 139,754,335 bp
  • A to G, chromosome 1 at 178,111,558 bp
  • A to T, chromosome 2 at 21,399,416 bp
  • T to C, chromosome 2 at 53,157,915 bp
  • C to A, chromosome 3 at 46,446,703 bp
  • A to G, chromosome 3 at 54,789,186 bp
  • A to G, chromosome 3 at 89,070,527 bp
  • T to C, chromosome 4 at 83,474,373 bp
  • C to T, chromosome 4 at 104,731,751 bp
  • C to A, chromosome 4 at 136,541,266 bp
  • T to C, chromosome 4 at 139,280,013 bp
  • A to G, chromosome 5 at 31,052,866 bp
  • C to T, chromosome 5 at 61,809,871 bp
  • C to A, chromosome 7 at 19,524,603 bp
  • GCGGCGGCG to GCGGCGGCGTCGGCGGCG, chromosome 7 at 97,579,925 bp
  • AACTCTGTCACT to AACT, chromosome 7 at 108,095,525 bp
  • T to A, chromosome 8 at 13,292,077 bp
  • A to G, chromosome 9 at 21,038,749 bp
  • A to G, chromosome 9 at 25,150,834 bp
  • G to A, chromosome 10 at 81,588,872 bp
  • A to T, chromosome 11 at 53,958,038 bp
  • A to G, chromosome 11 at 87,761,703 bp
  • T to C, chromosome 11 at 110,090,050 bp
  • A to G, chromosome 12 at 30,003,112 bp
  • A to C, chromosome 13 at 63,360,248 bp
  • A to T, chromosome 13 at 75,115,255 bp
  • C to T, chromosome 15 at 79,252,937 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • A to C, chromosome 16 at 88,506,571 bp
  • A to T, chromosome 17 at 37,010,411 bp
  • C to T, chromosome 17 at 88,569,185 bp
  • G to A, chromosome 18 at 36,006,723 bp
  • A to G, chromosome 18 at 37,716,082 bp
  • C to T, chromosome 19 at 20,789,590 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6200 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044340-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.