Strain Name:
C57BL/6J-MtgxR6207Btlr
Stock Number:
044341-MU
Citation ID:
RRID:MMRRC_044341-MU
Other Names:
R6207 (G1)
Major Collection:

Strain Information

Lims1
Name: LIM and senescent cell antigen-like domains 1
Synonyms: Lims1l, PINCH1, 2310016J22Rik, 4921524A02Rik, C430041B13Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 110829
HGNC: HGNC:6616
Homologene: 68428
Fbxo36
Name: F-box protein 36
Synonyms: 0610008D19Rik, 2410002G19Rik, 1110020F21Rik, D1Ertd757e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 66153
Homologene: 11927
Kcnq2
Name: potassium voltage-gated channel, subfamily Q, member 2
Synonyms: Nmf134, KQT2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16536
HGNC: HGNC:6296
Homologene: 26174
Nek6
Name: NIMA (never in mitosis gene a)-related expressed kinase 6
Synonyms: 1300007C09Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 59126
HGNC: HGNC:7749
Homologene: 49379
Spop
Name: speckle-type BTB/POZ protein
Synonyms: TEF2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20747
Homologene: 68354
Dot1l
Name: DOT1-like, histone H3 methyltransferase (S. cerevisiae)
Synonyms: mDot1, KMT4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 208266
Homologene: 32779
Snrnp200
Name: small nuclear ribonucleoprotein 200 (U5)
Synonyms: A330064G03Rik, HELIC2, U5-200KD, Ascc3l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 320632
Homologene: 5859
Ahctf1
Name: AT hook containing transcription factor 1
Synonyms: Elys, 6230412P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 226747
Homologene: 9142
Prpf40a
Name: pre-mRNA processing factor 40A
Synonyms: FBP11, 2810012K09Rik, Fnbp3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 56194
Homologene: 6377
Slc25a17
Name: solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein), member 17
Synonyms: PMP34, 34kDa
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 20524
VEGA: 15
Homologene: 4637
Epcam
Name: epithelial cell adhesion molecule
Synonyms: GA733-2, gp40, EpCAM, Tacstd1, EGP-2, CD326, TROP1, Ep-CAM, panepithelial glycoprotein 314, Ly74, Egp314, EpCAM1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 17075
VEGA: 17
Homologene: 1764
Zfp180
Name: zinc finger protein 180
Synonyms: HHZ168, 2310040I01Rik, D130011P11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 210135
Homologene: 8306
Mcm2
Name: minichromosome maintenance complex component 2
Synonyms: Mcmd2, BM28, CDCL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 17216
HGNC: HGNC:6944
Homologene: 3325
Dab1
Name: disabled 1
Synonyms: C630028C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 13131
HGNC: HGNC:2661
Homologene: 32084
Psap
Name: prosaposin
Synonyms: SGP-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 19156
HGNC: HGNC:9498
Homologene: 37680
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: LOC381562, D930005K06Rik, Zubr1, p600, A930005E13Rik, 1810009A16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 69116
Homologene: 10804
Etnk1
Name: ethanolamine kinase 1
Synonyms: 4930555L11Rik, 1110061E11Rik, D6Ertd3e, EKI1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 75320
Homologene: 10240
Rasa3
Name: RAS p21 protein activator 3
Synonyms: scat, GAPIII activator 3, R-Ras gap, hlb381, GAPIII, Ras GTPase-activating protein III
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 19414
Homologene: 7217
Prune2
Name: prune homolog 2
Synonyms: A230083H22Rik, Olfaxin, 6330414G02Rik, A330102H22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Fbl
Name: fibrillarin
Synonyms: RNU3IP1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 14113
HGNC: HGNC:3599
Homologene: 1099
Man2a1
Name: mannosidase 2, alpha 1
Synonyms: Mana-2, Map-2, Mana2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 17158
HGNC: HGNC:6824
Homologene: 1777
Acbd5
Name: acyl-Coenzyme A binding domain containing 5
Synonyms: 1300014E15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74159
Homologene: 12541
Gak
Name: cyclin G associated kinase
Synonyms: D130045N16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231580
HGNC: HGNC:4113
Homologene: 3846
L1td1
Name: LINE-1 type transposase domain containing 1
Synonyms: ECAT11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 381591
Homologene: 135709
Tspan12
Name: tetraspanin 12
Synonyms: Tm4sf12
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 269831
Homologene: 8212
Foxn3
Name: forkhead box N3
Synonyms: 5430426H20Rik, Ches1l, Ches1, HTLFL1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 71375
HGNC: HGNC:1928
Homologene: 135955
Peg10
Name: paternally expressed 10
Synonyms: Rtl2, MyEF-3 like, Edr, MyEF-3, Mart2, Mar2, HB-1, MEF3L
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 170676
Homologene: 116067
Slfn4
Name: schlafen 4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20558
Homologene: 133236
Tbkbp1
Name: TBK1 binding protein 1
Synonyms: 3110043L15Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 73174
Homologene: 8820
Scaf1
Name: SR-related CTD-associated factor 1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233208
Calcrl
Name: calcitonin receptor-like
Synonyms: CRLR
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 54598
Homologene: 21179
Unc13c
Name: unc-13 homolog C
Synonyms: Unc13h3, Munc13-3, 1500037O19Rik, D9Ertd414e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208898
Homologene: 45443
Vmn2r61
Name: vomeronasal 2, receptor 61
Synonyms: Gprc2a-rs2, EG637873, Casr-rs2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 637873
Homologene: 129683
Abca15
Name: ATP-binding cassette, sub-family A (ABC1), member 15
Synonyms: 4930500I12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 320631
Homologene: 87255
Gprc6a
Name: G protein-coupled receptor, family C, group 6, member A
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 210198
VEGA: 10
Homologene: 17529
Hrg
Name: histidine-rich glycoprotein
Synonyms: D16JH2, D18020
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 94175
HGNC: HGNC:5181
Homologene: 137650
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 210876
Homologene: 86604
Ubqlnl
Name: ubiquilin-like
Synonyms: 4922504M18Rik, LOC244179
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 244179
Homologene: 17034
Ighv1-4
Name: immunoglobulin heavy variable 1-4
Synonyms: Gm16694
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 432702
Htatip2
Name: HIV-1 Tat interactive protein 2
Synonyms: TIP30
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 53415
Homologene: 4676
Cep85l
Name: centrosomal protein 85-like
Synonyms: Gm9766
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 100038725
VEGA: 10
Homologene: 52598
B4galnt3
Name: beta-1,4-N-acetyl-galactosaminyl transferase 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330406
Homologene: 18328
Vwa5a
Name: von Willebrand factor A domain containing 5A
Synonyms: Loh11cr2a, 5830475I06Rik, BCSC-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 67776
HGNC: HGNC:6658
Homologene: 18222
Or14c46
Name: olfactory receptor family 14 subfamily C member 46
Synonyms: Olfr310, MOR227-6P, GA_x6K02T2NHDJ-9838699-9839697
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258222
Homologene: 128066
Pus1
Name: pseudouridine synthase 1
Synonyms: MPUS1, mPus1p, A730013B20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56361
Homologene: 5931
Cpne9
Name: copine family member IX
Synonyms: A730016F12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 211232
Homologene: 84686
Cckar
Name: cholecystokinin A receptor
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 12425
HGNC: HGNC:1570
Homologene: 37337
Mdga1
Name: MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms: Mamdc3, 1200011I03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 74762
Homologene: 17780
Or10d1b
Name: olfactory receptor family 10 subfamily D member 1B
Synonyms: MOR224-8, Olfr149, GA_x6K02T2PVTD-33400306-33399371, M31
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 235256
VEGA: 9
Homologene: 28452
Ak3
Name: adenylate kinase 3
Synonyms: AK-3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 56248
Homologene: 21744
Entrep1
Name: endosomal transmembrane epsin interactor 1
Synonyms: Fam189a2, LOC381217
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 381217
VEGA: 19
Homologene: 3540
Slc22a20
Name: solute carrier family 22 (organic anion transporter), member 20
Synonyms: mOAT6, LOC381203
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 381203
Homologene: 87203
Vmn2r4
Name: vomeronasal 2, receptor 4
Synonyms: EG637053
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 637053
Homologene: 129754
Timd4
Name: T cell immunoglobulin and mucin domain containing 4
Synonyms: TIM-4, Tim4, B430010N18Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 276891
Homologene: 51381
Zfp672
Name: zinc finger protein 672
Synonyms: 4930511N19Rik, 4930488P06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 319475
Homologene: 23493
Myb
Name: myeloblastosis oncogene
Synonyms: c-myb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 17863
HGNC: HGNC:7545
Homologene: 31311
Fam170a
Name: family with sequence similarity 170, member A
Synonyms: Znfd, LOC225497
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 225497
VEGA: 18
Homologene: 86702
Krt39
Name: keratin 39
Synonyms: 4732494G06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237934
Homologene: 19078
Skap1
Name: src family associated phosphoprotein 1
Synonyms: 1700091G21Rik, Skap-55
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 78473
Homologene: 2764
Tulp1
Name: tubby like protein 1
Synonyms: Tulp1l
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 22157
Homologene: 2491
Commd7
Name: COMM domain containing 7
Synonyms: mU3, 2310010I22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 99311
Homologene: 24933
Thumpd2
Name: THUMP domain containing 2
Synonyms: 2810025A12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 72167
VEGA: 17
Homologene: 11898
Lgalsl
Name: galectin like
Synonyms: 1110067D22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216551
Homologene: 8581
Surf1
Name: surfeit gene 1
Synonyms: 0610010F23Rik, Surf-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20930
Homologene: 2387
Casp7
Name: caspase 7
Synonyms: caspase-7, Mch3, ICE-IAP3, CMH-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 12369
VEGA: 19
HGNC: HGNC:1508
Homologene: 11168
Or52a33
Name: olfactory receptor family 52 subfamily A member 33
Synonyms: GA_x6K02T2PBJ9-6362863-6361910, Olfr622, MOR26-1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 259087
Homologene: 100540
4930451I11Rik
Name: RIKEN cDNA 4930451I11 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 78118
Homologene: 52331
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: Cklfsf1, CKLFH1, CHLFH1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Or56b2j
Name: olfactory receptor family 56 subfamily B member 2J
Synonyms: MOR40-12, GA_x6K02T2PBJ9-7331927-7332961, Olfr663
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 257914
Homologene: 133594
Trav16
Name: T cell receptor alpha variable 16
Synonyms: Gm13896
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 195297
Snai1
Name: snail family zinc finger 1
Synonyms: Sna1, Sna, Snail1, Snail
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20613
Homologene: 4363
Fer1l5
Name: fer-1-like 5 (C. elegans)
Synonyms: 4930533C12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100534273
Homologene: 85232
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 36,385,160 bp
  • T to A, chromosome 1 at 84,896,530 bp
  • A to T, chromosome 1 at 179,777,390 bp
  • T to C, chromosome 2 at 23,069,478 bp
  • T to C, chromosome 2 at 26,914,807 bp
  • T to C, chromosome 2 at 38,557,834 bp
  • T to C, chromosome 2 at 53,157,915 bp
  • T to C, chromosome 2 at 84,333,530 bp
  • T to A, chromosome 2 at 127,210,735 bp
  • T to C, chromosome 2 at 153,632,610 bp
  • T to A, chromosome 2 at 167,538,309 bp
  • T to C, chromosome 2 at 181,113,233 bp
  • G to A, chromosome 3 at 64,406,505 bp
  • G to A, chromosome 4 at 98,737,418 bp
  • C to T, chromosome 4 at 104,731,751 bp
  • G to A, chromosome 4 at 139,421,248 bp
  • A to G, chromosome 5 at 53,699,844 bp
  • C to T, chromosome 5 at 108,625,029 bp
  • T to C, chromosome 5 at 110,777,714 bp
  • GAT to GATCAT, chromosome 6 at 4,756,449 bp
  • T to C, chromosome 6 at 21,799,908 bp
  • G to T, chromosome 6 at 88,885,862 bp
  • A to T, chromosome 6 at 113,294,773 bp
  • A to T, chromosome 6 at 120,206,614 bp
  • A to G, chromosome 6 at 143,180,798 bp
  • A to T, chromosome 7 at 24,105,085 bp
  • T to C, chromosome 7 at 28,174,853 bp
  • A to T, chromosome 7 at 42,260,192 bp
  • G to T, chromosome 7 at 45,007,623 bp
  • G to A, chromosome 7 at 49,770,819 bp
  • A to C, chromosome 7 at 86,269,760 bp
  • A to G, chromosome 7 at 103,640,002 bp
  • A to T, chromosome 7 at 104,148,708 bp
  • G to A, chromosome 7 at 104,703,611 bp
  • A to G, chromosome 7 at 120,373,794 bp
  • G to A, chromosome 7 at 126,830,893 bp
  • T to C, chromosome 8 at 13,598,251 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 9 at 38,722,672 bp
  • T to C, chromosome 9 at 39,702,310 bp
  • T to C, chromosome 9 at 73,758,628 bp
  • A to G, chromosome 10 at 21,145,322 bp
  • T to C, chromosome 10 at 51,626,835 bp
  • T to C, chromosome 10 at 53,281,555 bp
  • A to T, chromosome 10 at 58,394,564 bp
  • T to A, chromosome 10 at 60,300,538 bp
  • C to T, chromosome 10 at 80,786,443 bp
  • T to A, chromosome 11 at 20,829,382 bp
  • A to T, chromosome 11 at 46,815,526 bp
  • T to C, chromosome 11 at 58,317,523 bp
  • C to T, chromosome 11 at 83,189,125 bp
  • G to T, chromosome 11 at 95,471,237 bp
  • T to A, chromosome 11 at 96,704,133 bp
  • T to C, chromosome 11 at 97,146,339 bp
  • G to T, chromosome 11 at 99,521,215 bp
  • G to T, chromosome 12 at 99,196,310 bp
  • A to T, chromosome 12 at 114,487,522 bp
  • A to T, chromosome 14 at 53,743,588 bp
  • T to C, chromosome 15 at 81,329,064 bp
  • T to C, chromosome 16 at 22,954,538 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • A to T, chromosome 17 at 28,358,677 bp
  • G to A, chromosome 17 at 29,838,517 bp
  • T to C, chromosome 17 at 64,713,605 bp
  • G to A, chromosome 17 at 81,055,837 bp
  • C to A, chromosome 17 at 87,640,436 bp
  • A to T, chromosome 18 at 50,281,950 bp
  • A to G, chromosome 19 at 5,985,941 bp
  • T to A, chromosome 19 at 17,118,116 bp
  • T to C, chromosome 19 at 23,973,438 bp
  • T to A, chromosome 19 at 29,022,940 bp
  • T to A, chromosome 19 at 56,441,020 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6207 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044341-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.