Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6207Btlr/Mmmh
Stock Number:
044341-MU
Citation ID:
RRID:MMRRC_044341-MU
Other Names:
R6207 (G1)
Major Collection:

Strain Information

Lims1
Name: LIM and senescent cell antigen-like domains 1
Synonyms: 2310016J22Rik, 4921524A02Rik, Lims1l, PINCH1, C430041B13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110829
HGNC: HGNC:6616
Homologene: 68428
Fbxo36
Name: F-box protein 36
Synonyms: 0610008D19Rik, 2410002G19Rik, 1110020F21Rik, D1Ertd757e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66153
Homologene: 11927
Nek6
Name: NIMA (never in mitosis gene a)-related expressed kinase 6
Synonyms: 1300007C09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59126
HGNC: HGNC:7749
Homologene: 49379
Spop
Name: speckle-type BTB/POZ protein
Synonyms: TEF2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20747
Homologene: 68354
Dot1l
Name: DOT1 like histone lysine methyltransferase
Synonyms: mDot1, KMT4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 208266
Homologene: 32779
Snrnp200
Name: small nuclear ribonucleoprotein 200 (U5)
Synonyms: U5-200KD, HELIC2, A330064G03Rik, Ascc3l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320632
Homologene: 5859
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 36,385,160 bp
  • T to A, chromosome 1 at 84,896,530 bp
  • A to T, chromosome 1 at 179,777,390 bp
  • T to C, chromosome 2 at 23,069,478 bp
  • T to C, chromosome 2 at 26,914,807 bp
  • T to C, chromosome 2 at 38,557,834 bp
  • T to C, chromosome 2 at 53,157,915 bp
  • T to C, chromosome 2 at 84,333,530 bp
  • T to A, chromosome 2 at 127,210,735 bp
  • T to C, chromosome 2 at 153,632,610 bp
  • T to A, chromosome 2 at 167,538,309 bp
  • T to C, chromosome 2 at 181,113,233 bp
  • G to A, chromosome 3 at 64,406,505 bp
  • G to A, chromosome 4 at 98,737,418 bp
  • C to T, chromosome 4 at 104,731,751 bp
  • G to A, chromosome 4 at 139,421,248 bp
  • A to G, chromosome 5 at 53,699,844 bp
  • C to T, chromosome 5 at 108,625,029 bp
  • T to C, chromosome 5 at 110,777,714 bp
  • GAT to GATCAT, chromosome 6 at 4,756,449 bp
  • T to C, chromosome 6 at 21,799,908 bp
  • G to T, chromosome 6 at 88,885,862 bp
  • A to T, chromosome 6 at 113,294,773 bp
  • A to T, chromosome 6 at 120,206,614 bp
  • A to G, chromosome 6 at 143,180,798 bp
  • A to T, chromosome 7 at 24,105,085 bp
  • T to C, chromosome 7 at 28,174,853 bp
  • A to T, chromosome 7 at 42,260,192 bp
  • G to T, chromosome 7 at 45,007,623 bp
  • G to A, chromosome 7 at 49,770,819 bp
  • A to C, chromosome 7 at 86,269,760 bp
  • A to G, chromosome 7 at 103,640,002 bp
  • A to T, chromosome 7 at 104,148,708 bp
  • G to A, chromosome 7 at 104,703,611 bp
  • A to G, chromosome 7 at 120,373,794 bp
  • G to A, chromosome 7 at 126,830,893 bp
  • T to C, chromosome 8 at 13,598,251 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 9 at 38,722,672 bp
  • T to C, chromosome 9 at 39,702,310 bp
  • T to C, chromosome 9 at 73,758,628 bp
  • A to G, chromosome 10 at 21,145,322 bp
  • T to C, chromosome 10 at 51,626,835 bp
  • T to C, chromosome 10 at 53,281,555 bp
  • A to T, chromosome 10 at 58,394,564 bp
  • T to A, chromosome 10 at 60,300,538 bp
  • C to T, chromosome 10 at 80,786,443 bp
  • T to A, chromosome 11 at 20,829,382 bp
  • A to T, chromosome 11 at 46,815,526 bp
  • T to C, chromosome 11 at 58,317,523 bp
  • C to T, chromosome 11 at 83,189,125 bp
  • G to T, chromosome 11 at 95,471,237 bp
  • T to A, chromosome 11 at 96,704,133 bp
  • T to C, chromosome 11 at 97,146,339 bp
  • G to T, chromosome 11 at 99,521,215 bp
  • G to T, chromosome 12 at 99,196,310 bp
  • A to T, chromosome 12 at 114,487,522 bp
  • A to T, chromosome 14 at 53,743,588 bp
  • T to C, chromosome 15 at 81,329,064 bp
  • T to C, chromosome 16 at 22,954,538 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • A to T, chromosome 17 at 28,358,677 bp
  • G to A, chromosome 17 at 29,838,517 bp
  • T to C, chromosome 17 at 64,713,605 bp
  • G to A, chromosome 17 at 81,055,837 bp
  • C to A, chromosome 17 at 87,640,436 bp
  • A to T, chromosome 18 at 50,281,950 bp
  • A to G, chromosome 19 at 5,985,941 bp
  • T to A, chromosome 19 at 17,118,116 bp
  • T to C, chromosome 19 at 23,973,438 bp
  • T to A, chromosome 19 at 29,022,940 bp
  • T to A, chromosome 19 at 56,441,020 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6207 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044341-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.