Strain Name:
C57BL/6J-MtgxR4875Btlr/Mmmh
Stock Number:
044392-MU
Citation ID:
RRID:MMRRC_044392-MU
Other Names:
R4875 (G1)
Major Collection:

Strain Information

Strap
Name: serine/threonine kinase receptor associated protein
Synonyms: C78091, Unrip
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 20901
Homologene: 43881
Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Ndufv1
Name: NADH:ubiquinone oxidoreductase core subunit V1
Synonyms: 24 kDa (FP)
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 17995
HGNC: HGNC:7716
Homologene: 5151
Synj2
Name: synaptojanin 2
Synonyms: SJ2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 20975
Homologene: 117703
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237877
Homologene: 32611
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 18541
VEGA: 10
Tpx2
Name: TPX2, microtubule-associated
Synonyms: REPP86, DIL2, p100, 2610005B21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 72119
HGNC: HGNC:1249
Homologene: 8107
Helz
Name: helicase with zinc finger domain
Synonyms: 9630002H22Rik, 9430093I07Rik, 3110078M01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 78455
Homologene: 8918
Mcph1
Name: microcephaly, primary autosomal recessive 1
Synonyms: 5430437K10Rik, BRIT1, D030046N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 244329
HGNC: HGNC:6954
Homologene: 32586
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Xpo7
Name: exportin 7
Synonyms: Ranbp16, 4930506C02Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 65246
VEGA: 14
Homologene: 22857
Hnf1a
Name: HNF1 homeobox A
Synonyms: hepatocyte nuclear factor 1, HNF1-alpha, HNF1[a], HNF1, Hnf-1, Hnf1alpha, LFB1, Tcf1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 21405
Homologene: 459
Osbpl11
Name: oxysterol binding protein-like 11
Synonyms: ORP-11
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 16
NCBI: 106326
Homologene: 23385
Lhx4
Name: LIM homeobox protein 4
Synonyms: Gsh-4, Gsh4, A330062J17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 16872
Homologene: 56497
Cecr2
Name: CECR2, histone acetyl-lysine reader
Synonyms: 2810409N01Rik, 2610101O16Rik, Gtl4, cat eye syndrome chromosome region, candidate 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 330409
HGNC: HGNC:1840
Homologene: 64662
Bbs9
Name: Bardet-Biedl syndrome 9
Synonyms: EST 3159894, E130103I17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 319845
Homologene: 44480
Ncam1
Name: neural cell adhesion molecule 1
Synonyms: CD56, NCAM-1, NCAM-120, NCAM-140, NCAM-180, E-NCAM, NCAM
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 17967
HGNC: HGNC:7656
Homologene: 40754
Prox1
Name: prospero homeobox 1
Synonyms: A230003G05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 19130
HGNC: HGNC:9459
Homologene: 2069
Pnkp
Name: polynucleotide kinase 3'- phosphatase
Synonyms: PNK, 1810009G08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 59047
HGNC: HGNC:9154
Homologene: 5247
Gm14496
Name: predicted gene 14496
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 672125
Homologene: 129606
Tpst2
Name: protein-tyrosine sulfotransferase 2
Synonyms: grm, D5Ucla3, grt, Tango13b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 22022
Homologene: 2666
Wdr4
Name: WD repeat domain 4
Synonyms: D530049K22Rik, Wh
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 57773
Homologene: 32422
Mis18bp1
Name: MIS18 binding protein 1
Synonyms: C79407
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 217653
Homologene: 10147
Ehbp1
Name: EH domain binding protein 1
Synonyms: Flj21950, KIAA0903-like
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 216565
Homologene: 22880
Mcoln1
Name: mucolipin 1
Synonyms: 2210015I05Rik, mucolipidin, TRPML1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 94178
Homologene: 10744
Scn1a
Name: sodium channel, voltage-gated, type I, alpha
Synonyms: Nav1.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 20265
Homologene: 21375
Sp9
Name: trans-acting transcription factor 9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 381373
Homologene: 66935
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 20739
Homologene: 74460
Plpp2
Name: phospholipid phosphatase 2
Synonyms: Lpp2, Ppap2c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 50784
HGNC: HGNC:9230
Homologene: 2752
Kcns1
Name: K+ voltage-gated channel, subfamily S, 1
Synonyms: Kv9.1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 16538
HGNC: HGNC:6300
Homologene: 20517
Cpne8
Name: copine VIII
Synonyms: 1200003E11Rik, 1500031E20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 66871
Homologene: 12049
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, D9Ertd414e, 1500037O19Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 208898
Homologene: 45443
Dll3
Name: delta like canonical Notch ligand 3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 13389
HGNC: HGNC:2909
Homologene: 7291
Nlrp2
Name: NLR family, pyrin domain containing 2
Synonyms: PYPAF2, E330007A02Rik, Nalp2, Pan1, Nbs1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 232827
Homologene: 56789
Mroh2a
Name: maestro heat-like repeat family member 2A
Synonyms: ENSMUSG00000044873, OTTMUSG00000020804, Heatr7b1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100040766
Homologene: 85300
Tuba8
Name: tubulin, alpha 8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 53857
Homologene: 56766
Vmn1r59
Name: vomeronasal 1 receptor 59
Synonyms: V1rd10
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 404284
Homologene: 41799
Pwwp2b
Name: PWWP domain containing 2B
Synonyms: D930023J19Rik, D7Ertd517e, Pwwp2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 101631
Homologene: 19056
Gsdmc2
Name: gasdermin C2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 331063
HGNC: HGNC:7151
Homologene: 69487
Trmt1l
Name: tRNA methyltransferase 1 like
Synonyms: Trm1-like, 1190005F20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 98685
Homologene: 12801
Cntn4
Name: contactin 4
Synonyms: BIG-2A, Axcam
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 269784
HGNC: HGNC:2174
Homologene: 14257
Or10a49
Name: olfactory receptor family 10 subfamily A member 49
Synonyms: GA_x6K02T2PBJ9-11199311-11198367, MOR268-4, Olfr517
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 258136
Homologene: 79413
Myom1
Name: myomesin 1
Synonyms: skelemin, D430047A17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 17929
VEGA: 17
HGNC: HGNC:7613
Homologene: 31196
Rims4
Name: regulating synaptic membrane exocytosis 4
Synonyms: Rim4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 241770
Homologene: 18123
Tnrc18
Name: trinucleotide repeat containing 18
Synonyms: EG381742, Zfp469
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 231861
Homologene: 45603
Or2ad1
Name: olfactory receptor family 2 subfamily AD member 1
Synonyms: GA_x6K02T2QHY8-12104556-12105500, MOR256-15, Olfr1368
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 258527
Homologene: 105156
Kif26b
Name: kinesin family member 26B
Synonyms: N-11 kinesin, D230039L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 269152
Homologene: 18623
Luzp2
Name: leucine zipper protein 2
Synonyms: 9330154K17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 233271
Homologene: 45618
Alox5
Name: arachidonate 5-lipoxygenase
Synonyms: 5LO, 5-LOX, 5LX
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 11689
HGNC: HGNC:435
Homologene: 561
Ctso
Name: cathepsin O
Synonyms: A330105D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 229445
HGNC: HGNC:2542
Homologene: 1020
Vmn2r87
Name: vomeronasal 2, receptor 87
Synonyms: EG625131
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 625131
Homologene: 129606
Slc23a2
Name: solute carrier family 23 (nucleobase transporters), member 2
Synonyms: YSPL3, SVCT2, Slc23a1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 54338
Homologene: 68440
Cyp3a16
Name: cytochrome P450, family 3, subfamily a, polypeptide 16
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 13114
Homologene: 133568
Cnpy2
Name: canopy FGF signaling regulator 2
Synonyms: Zsig9, 5330432A10Rik, D10Bwg1546e, Tmem4
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 56530
VEGA: 10
Homologene: 40934
Dqx1
Name: DEAQ RNA-dependent ATPase
Synonyms: 2310066E11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 93838
Homologene: 14143
Lair1
Name: leukocyte-associated Ig-like receptor 1
Synonyms: 5133400O11Rik, mLair-1, Lair-1, D7Bwg0421e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 52855
Homologene: 48097
Mospd4
Name: motile sperm domain containing 4
Synonyms: 2010013H21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 72076
Ehd3
Name: EH-domain containing 3
Synonyms: Ehd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 57440
HGNC: HGNC:3244
Homologene: 81837
Gm4353
Name: predicted gene 4353
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 100043313
VEGA: 7
Zfp827
Name: zinc finger protein 827
Synonyms: 2810449M09Rik, D630040G17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 622675
Homologene: 45622
Mgat5
Name: mannoside acetylglucosaminyltransferase 5
Synonyms: GlcNAc-TV, beta1,6N-acetylglucosaminyltransferase V, 5330407H02Rik, 4930471A21Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 107895
HGNC: HGNC:7049
Homologene: 1808
Ccdc112
Name: coiled-coil domain containing 112
Synonyms: 8430438M01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 240261
VEGA: 18
Homologene: 17617
Prl7c1
Name: prolactin family 7, subfamily c, member 1
Synonyms: PLP-O, 1600017N11Rik, Prlpo
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67505
HGNC: HGNC:9445
Homologene: 137377
Catsperb
Name: cation channel sperm associated auxiliary subunit beta
Synonyms: 4932415G16Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 271036
VEGA: 12
Homologene: 81904
Ces2e
Name: carboxylesterase 2E
Synonyms: 9030624L02Rik, Ces5
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 234673
HGNC: HGNC:1864
Homologene: 86210
Ero1b
Name: endoplasmic reticulum oxidoreductase 1 beta
Synonyms: 1700065B09Rik, 1300013B24Rik, Ero1lb
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 67475
VEGA: 13
Homologene: 8740
Plat
Name: plasminogen activator, tissue
Synonyms: t-PA, tPA, D8Ertd2e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 18791
HGNC: HGNC:9051
Homologene: 717
Dnah7c
Name: dynein, axonemal, heavy chain 7C
Synonyms: Dnahc7c
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 100101919
Homologene: 41287
Zfp971
Name: zinc finger protein 971
Synonyms: Etohi1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 626848
Homologene: 134324
Krt9
Name: keratin 9
Synonyms: K9, Krt1-9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Ak1
Name: adenylate kinase 1
Synonyms: Ak-1, B430205N08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 11636
HGNC: HGNC:361
Homologene: 20135
Pax8
Name: paired box 8
Synonyms: Pax-8
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 18510
HGNC: HGNC:8622
Homologene: 2589
Or10q12
Name: olfactory receptor family 10 subfamily Q member 12
Synonyms: GA_x6K02T2RE5P-4101369-4102328, MOR266-9, Olfr1495
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 258341
Homologene: 73965
Tgif2-ps2
Name: TGFB-induced factor homeobox 2, pseudogene 2
Synonyms: Gm7148
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
NCBI: 634967
Naa80
Name: N(alpha)-acetyltransferase 80, NatH catalytic subunit
Synonyms: Nat6
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 56441
Homologene: 36325
Ubiad1
Name: UbiA prenyltransferase domain containing 1
Synonyms: Tere1, 1200002M06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 71707
Homologene: 8336
Fpgt
Name: fucose-1-phosphate guanylyltransferase
Synonyms: 1700016E03Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
NCBI: 75540
HGNC: HGNC:3825
Homologene: 2847
Igkv4-80
Name: immunoglobulin kappa variable 4-80
Synonyms: Gm16729
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 545848
Dnase1l1
Name: deoxyribonuclease 1-like 1
Synonyms: G4.8, Dnl1ll, 2310005K03Rik, Dnase1ll
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 69537
HGNC: HGNC:2957
Homologene: 4896
BB019430
Name: expressed sequence BB019430
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 103505
VEGA: 10
Tcstv2c
Name: two cell stage variable group member 2C
Synonyms: Gm20767
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 13
NCBI: 639910
VEGA: 13
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 46,688,925 bp
  • G to T, chromosome 1 at 88,254,935 bp
  • G to A, chromosome 1 at 127,469,249 bp
  • A to G, chromosome 1 at 151,455,004 bp
  • T to C, chromosome 1 at 155,705,267 bp
  • T to A, chromosome 1 at 174,175,830 bp
  • A to G, chromosome 1 at 178,915,327 bp
  • A to C, chromosome 1 at 190,162,122 bp
  • T to A, chromosome 2 at 24,441,640 bp
  • A to T, chromosome 2 at 32,631,177 bp
  • T to C, chromosome 2 at 66,328,476 bp
  • T to C, chromosome 2 at 73,273,618 bp
  • A to G, chromosome 2 at 132,056,880 bp
  • C to A, chromosome 2 at 152,893,615 bp
  • A to T, chromosome 2 at 163,865,523 bp
  • T to C, chromosome 2 at 164,168,101 bp
  • A to G, chromosome 2 at 178,033,147 bp
  • A to T, chromosome 2 at 181,997,433 bp
  • C to T, chromosome 3 at 81,942,381 bp
  • G to A, chromosome 3 at 155,087,913 bp
  • T to C, chromosome 4 at 148,444,099 bp
  • T to A, chromosome 5 at 112,309,821 bp
  • T to C, chromosome 5 at 114,970,673 bp
  • T to C, chromosome 5 at 115,576,170 bp
  • A to T, chromosome 5 at 142,765,177 bp
  • C to A, chromosome 5 at 145,452,849 bp
  • A to C, chromosome 6 at 69,016,665 bp
  • C to A, chromosome 6 at 83,061,012 bp
  • G to A, chromosome 6 at 106,437,913 bp
  • A to T, chromosome 6 at 116,413,850 bp
  • T to C, chromosome 6 at 120,750,916 bp
  • T to A, chromosome 6 at 121,226,083 bp
  • ACCTGCCCTCCT to ACCT, chromosome 6 at 137,749,318 bp
  • A to T, chromosome 7 at 4,029,034 bp
  • A to T, chromosome 7 at 5,298,859 bp
  • G to T, chromosome 7 at 5,454,109 bp
  • A to G, chromosome 7 at 28,296,435 bp
  • C to T, chromosome 7 at 44,862,403 bp
  • A to G, chromosome 7 at 55,167,248 bp
  • A to T, chromosome 7 at 108,868,786 bp
  • G to C, chromosome 7 at 116,084,413 bp
  • A to T, chromosome 7 at 139,256,062 bp
  • T to A, chromosome 8 at 3,507,422 bp
  • A to G, chromosome 8 at 18,625,558 bp
  • T to A, chromosome 8 at 22,768,450 bp
  • T to A, chromosome 8 at 79,060,774 bp
  • T to A, chromosome 8 at 104,927,185 bp
  • T to C, chromosome 9 at 22,578,715 bp
  • T to C, chromosome 9 at 49,507,621 bp
  • T to C, chromosome 9 at 73,517,284 bp
  • C to T, chromosome 9 at 107,583,619 bp
  • A to G, chromosome 10 at 58,704,043 bp
  • T to C, chromosome 10 at 76,369,854 bp
  • G to A, chromosome 10 at 79,530,929 bp
  • C to A, chromosome 10 at 128,326,095 bp
  • T to C, chromosome 10 at 130,472,498 bp
  • A to G, chromosome 11 at 22,101,164 bp
  • AGCTGCTGCTGCTGCTGCTGCTGCTG to AGCTGCTGCTGCTGCTGCTGCTG, chromosome 11 at 62,433,611 bp
  • T to C, chromosome 11 at 80,120,689 bp
  • T to C, chromosome 11 at 100,190,037 bp
  • T to A, chromosome 11 at 107,637,734 bp
  • G to A, chromosome 12 at 65,161,435 bp
  • A to T, chromosome 12 at 101,587,985 bp
  • C to A, chromosome 12 at 110,658,126 bp
  • G to A, chromosome 13 at 12,604,436 bp
  • T to A, chromosome 13 at 21,142,280 bp
  • T to C, chromosome 13 at 27,773,759 bp
  • T to C, chromosome 13 at 120,154,670 bp
  • T to C, chromosome 14 at 70,676,816 bp
  • C to T, chromosome 15 at 63,828,252 bp
  • T to A, chromosome 15 at 90,648,568 bp
  • G to A, chromosome 16 at 33,234,493 bp
  • A to T, chromosome 17 at 5,988,068 bp
  • A to G, chromosome 17 at 31,499,155 bp
  • A to G, chromosome 17 at 40,115,383 bp
  • T to C, chromosome 17 at 71,072,119 bp
  • T to G, chromosome 17 at 73,805,304 bp
  • A to G, chromosome 18 at 46,296,289 bp
  • G to T, chromosome 18 at 46,465,737 bp
  • T to C, chromosome 19 at 4,012,653 bp
  • T to A, chromosome 19 at 13,768,762 bp
  • C to T, chromosome X at 74,277,038 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4875 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu .
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044392-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.