Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6316Btlr/Mmmh
Stock Number:
044416-MU
Citation ID:
RRID:MMRRC_044416-MU
Other Names:
R6316 (G1)
Major Collection:

Strain Information

Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Kcnj1
Name: potassium inwardly-rectifying channel, subfamily J, member 1
Synonyms: ROMK-2, ROMK, Kir1.1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56379
VEGA: 9
HGNC: HGNC:6255
Homologene: 56764
Mtmr12
Name: myotubularin related protein 12
Synonyms: C730015A02Rik, Pip3ap
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268783
Homologene: 10403
Supt20
Name: SPT20 SAGA complex component
Synonyms: p38 interacting protein, p38IP, D3Ertd300e, Fam48a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56790
Homologene: 134155
Xrn2
Name: 5'-3' exoribonuclease 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24128
Homologene: 6927
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Tead1
Name: TEA domain family member 1
Synonyms: mTEF-1, TEF-1, TEAD-1, Tcf13, Gtrgeo5, B230114H05Rik, 2610024B07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21676
Homologene: 2418
Lpar6
Name: lysophosphatidic acid receptor 6
Synonyms: 2610302I02Rik, P2y5, P2ry5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67168
Homologene: 55925
Manf
Name: mesencephalic astrocyte-derived neurotrophic factor
Synonyms: 3230402M22Rik, Armet
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74840
Homologene: 4383
Krt33a
Name: keratin 33A
Synonyms: 2310015J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71888
HGNC: HGNC:6450
Homologene: 74433
Magel2
Name: MAGE family member L2
Synonyms: NDNL1, Mage-l2, nM15, ns7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27385
HGNC: HGNC:6814
Homologene: 8460
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Glis2
Name: GLIS family zinc finger 2
Synonyms: Nkl
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 83396
Homologene: 12821
Eno4
Name: enolase 4
Synonyms: 6430537H07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226265
Homologene: 18691
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: LOC381127, D930044O18Rik, D430002O22Rik, C230079D11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211961
Homologene: 19371
Smdt1
Name: single-pass membrane protein with aspartate rich tail 1
Synonyms: 1500032L24Rik, Emre
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69029
Homologene: 14110
Ksr2
Name: kinase suppressor of ras 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 333050
Homologene: 45469
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
H1f8
Name: H1.8 linker histone
Synonyms: H1oo, H1foo, H1-8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171506
Homologene: 51377
Grin2b
Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms: NMDAR2B, NR2B, Nmdar2b, GluRepsilon2, GluN2B
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14812
HGNC: HGNC:4586
Homologene: 646
Kansl1l
Name: KAT8 regulatory NSL complex subunit 1-like
Synonyms: C430010P07Rik, 1110028C15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68691
Homologene: 27376
Moxd2
Name: monooxygenase, DBH-like 2
Synonyms: Dbhl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194357
Homologene: 77226
Adam6a
Name: a disintegrin and metallopeptidase domain 6A
Synonyms: Adam6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238406
HGNC: HGNC:213
Homologene: 128362
Arhgef4
Name: Rho guanine nucleotide exchange factor 4
Synonyms: 9330140K16Rik, Asef, C230030N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226970
HGNC: HGNC:684
Homologene: 49414
Tor1aip2
Name: torsin A interacting protein 2
Synonyms: 15kDa, 1110020D10Rik, LULL1, Ifrg15
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240832
Homologene: 17028
Klhdc7a
Name: kelch domain containing 7A
Synonyms: B230308G19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242721
Homologene: 17567
Tmem163
Name: transmembrane protein 163
Synonyms: 2610024A01Rik, SV31
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72160
Homologene: 12798
Btbd2
Name: BTB domain containing 2
Synonyms: 2610037C03Rik, 4930512K17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 208198
Homologene: 32365
Vmn1r181
Name: vomeronasal 1 receptor 181
Synonyms: V1rd20
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404289
Homologene: 104166
Thoc2l
Name: THO complex subunit 2-like
Synonyms: Gm3179, BC005561
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100042165
Plch1
Name: phospholipase C, eta 1
Synonyms: PLCeta1, Plcl3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269437
Homologene: 88833
Tcte1
Name: t-complex-associated testis expressed 1
Synonyms: D17Sil1, Tcte-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21645
VEGA: 17
Homologene: 8434
Or9e1
Name: olfactory receptor family 9 subfamily E member 1
Synonyms: GA_x6K02T2NKPP-565870-564944, MOR222-1, Olfr311
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258530
Homologene: 77375
Smpd1
Name: sphingomyelin phosphodiesterase 1, acid lysosomal
Synonyms: A-SMase, aSMase, ASM, acid sphingomyelinase, Zn-SMase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20597
Homologene: 457
Trib1
Name: tribbles pseudokinase 1
Synonyms: A530090O15Rik, Trb1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 211770
Homologene: 75216
Rilpl2
Name: Rab interacting lysosomal protein-like 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80291
Homologene: 12723
Trgv2
Name: T cell receptor gamma variable 2
Synonyms: Vgamma2, Tcrg-V2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21636
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 34,723,477 bp
  • T to A, chromosome 1 at 66,735,585 bp
  • T to C, chromosome 1 at 71,313,959 bp
  • C to T, chromosome 1 at 127,551,365 bp
  • G to T, chromosome 1 at 156,062,094 bp
  • A to G, chromosome 2 at 147,042,010 bp
  • TCAGCAGCAGCAGCAGCAGCAGCA to TCAGCAGCAGCAGCAGCAGCAGCAGCA, chromosome 3 at 54,727,648 bp
  • C to T, chromosome 3 at 63,781,390 bp
  • T to C, chromosome 4 at 139,966,802 bp
  • G to C, chromosome 5 at 104,519,729 bp
  • A to G, chromosome 5 at 117,685,502 bp
  • A to G, chromosome 5 at 124,477,880 bp
  • T to A, chromosome 5 at 144,813,526 bp
  • T to C, chromosome 6 at 40,883,547 bp
  • T to C, chromosome 6 at 115,948,915 bp
  • A to T, chromosome 6 at 135,780,279 bp
  • T to A, chromosome 7 at 3,717,823 bp
  • G to A, chromosome 7 at 23,984,758 bp
  • T to C, chromosome 7 at 62,378,719 bp
  • T to C, chromosome 7 at 105,555,502 bp
  • C to A, chromosome 7 at 112,891,839 bp
  • T to C, chromosome 9 at 18,641,819 bp
  • A to T, chromosome 9 at 32,397,336 bp
  • A to G, chromosome 9 at 106,889,186 bp
  • T to A, chromosome 10 at 80,644,778 bp
  • A to G, chromosome 11 at 58,841,942 bp
  • T to C, chromosome 11 at 100,014,201 bp
  • A to T, chromosome 12 at 113,545,576 bp
  • G to A, chromosome 13 at 19,336,742 bp
  • T to C, chromosome 13 at 81,499,068 bp
  • A to G, chromosome 14 at 73,239,334 bp
  • T to A, chromosome 15 at 12,236,113 bp
  • T to C, chromosome 15 at 59,649,415 bp
  • T to C, chromosome 15 at 82,348,009 bp
  • T to A, chromosome 16 at 4,613,836 bp
  • T to C, chromosome 17 at 32,137,813 bp
  • A to G, chromosome 17 at 45,534,860 bp
  • A to G, chromosome 18 at 22,522,782 bp
  • G to A, chromosome 19 at 58,960,291 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6316 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044416-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.