Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6446Btlr/Mmmh
Stock Number:
044583-MU
Citation ID:
RRID:MMRRC_044583-MU
Other Names:
R6446 (G1)
Major Collection:

Strain Information

Map7
Name: microtubule-associated protein 7
Synonyms: E-MAP-115, mste, ste, mshi, Mtap7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
Blm
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12144
HGNC: HGNC:1058
Homologene: 47902
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Slc29a1
Name: solute carrier family 29 (nucleoside transporters), member 1
Synonyms: ENT1, NBMPR-sensitive equilibrative nucleoside transporter, 1200014D21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 63959
Homologene: 37985
Ccar2
Name: cell cycle activator and apoptosis regulator 2
Synonyms: 2610301G19Rik, Dbc1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219158
VEGA: 14
Homologene: 10910
Sh3glb1
Name: SH3-domain GRB2-like B1 (endophilin)
Synonyms: Bif-1, Endophilin B1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54673
Homologene: 9337
Cep350
Name: centrosomal protein 350
Synonyms: 6430546F08Rik, 4933409L06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74081
Homologene: 8879
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 155,862,154 bp
  • T to C, chromosome 2 at 125,251,019 bp
  • G to A, chromosome 3 at 90,172,068 bp
  • A to T, chromosome 3 at 96,171,188 bp
  • A to T, chromosome 3 at 100,103,132 bp
  • T to C, chromosome 3 at 144,705,605 bp
  • T to A, chromosome 5 at 92,033,217 bp
  • G to A, chromosome 5 at 100,695,569 bp
  • A to T, chromosome 5 at 100,768,384 bp
  • T to A, chromosome 5 at 121,334,375 bp
  • G to A, chromosome 5 at 123,161,799 bp
  • A to T, chromosome 6 at 64,345,593 bp
  • T to C, chromosome 7 at 27,537,731 bp
  • T to C, chromosome 7 at 29,206,567 bp
  • A to G, chromosome 7 at 67,734,966 bp
  • GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC to GCCTCCTCCTCCTCCTCCTCCTCCTCC, chromosome 7 at 80,512,904 bp
  • T to A, chromosome 7 at 86,527,102 bp
  • A to G, chromosome 7 at 109,894,666 bp
  • T to C, chromosome 9 at 78,059,783 bp
  • G to T, chromosome 9 at 86,755,653 bp
  • A to G, chromosome 9 at 123,964,106 bp
  • T to G, chromosome 10 at 20,278,233 bp
  • T to A, chromosome 11 at 119,027,926 bp
  • T to C, chromosome 12 at 104,239,082 bp
  • C to A, chromosome 13 at 58,345,716 bp
  • T to A, chromosome 14 at 26,629,534 bp
  • T to A, chromosome 14 at 70,143,069 bp
  • A to T, chromosome 16 at 17,212,929 bp
  • A to G, chromosome 16 at 30,361,869 bp
  • CGTCTGGATG to CG, chromosome 16 at 31,956,343 bp
  • G to A, chromosome 16 at 64,479,381 bp
  • C to T, chromosome 16 at 95,296,259 bp
  • A to T, chromosome 17 at 20,472,347 bp
  • A to G, chromosome 17 at 25,721,244 bp
  • A to T, chromosome 17 at 45,589,245 bp
  • A to C, chromosome 18 at 5,057,323 bp
  • A to G, chromosome 18 at 60,245,768 bp
  • G to T, chromosome 18 at 63,086,607 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6446 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044583-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.