Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6702Btlr/Mmmh
Stock Number:
044820-MU
Citation ID:
RRID:MMRRC_044820-MU
Other Names:
R6702 (G1)
Major Collection:

Strain Information

Atg7
Name: autophagy related 7
Synonyms: 1810013K23Rik, Apg7l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74244
Homologene: 4662
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Ubap2
Name: ubiquitin-associated protein 2
Synonyms: 1190005K07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68926
Homologene: 73649
Csnk2a1
Name: casein kinase 2, alpha 1 polypeptide
Synonyms: Csnk2a1-rs4, CK2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12995
Homologene: 90874
S1pr3
Name: sphingosine-1-phosphate receptor 3
Synonyms: LPb3, S1P3, Edg3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13610
VEGA: 13
HGNC: HGNC:3167
Homologene: 3829
Mef2c
Name: myocyte enhancer factor 2C
Synonyms: 9930028G15Rik, 5430401D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17260
HGNC: HGNC:6996
Homologene: 31087
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 90,779,439 bp
  • C to T, chromosome 1 at 91,427,949 bp
  • A to G, chromosome 1 at 162,318,687 bp
  • A to G, chromosome 1 at 167,613,805 bp
  • C to G, chromosome 1 at 178,917,287 bp
  • A to G, chromosome 2 at 25,249,890 bp
  • A to T, chromosome 2 at 69,956,049 bp
  • A to G, chromosome 2 at 71,546,227 bp
  • T to G, chromosome 2 at 76,720,112 bp
  • G to A, chromosome 2 at 88,340,242 bp
  • T to A, chromosome 2 at 111,490,109 bp
  • C to G, chromosome 2 at 136,059,563 bp
  • A to T, chromosome 2 at 144,559,189 bp
  • A to G, chromosome 2 at 152,258,688 bp
  • A to G, chromosome 2 at 180,919,133 bp
  • A to G, chromosome 3 at 56,005,502 bp
  • GCCCGCTTGCCCCGCT to GCCCGCTTGCCCCGCTTGCCCCGCT, chromosome 4 at 41,227,210 bp
  • T to C, chromosome 4 at 107,107,086 bp
  • C to T, chromosome 5 at 115,551,896 bp
  • T to A, chromosome 5 at 120,626,503 bp
  • A to G, chromosome 5 at 124,805,805 bp
  • GC to GCTCC, chromosome 6 at 4,756,452 bp
  • T to A, chromosome 6 at 24,449,745 bp
  • T to C, chromosome 6 at 42,268,051 bp
  • C to A, chromosome 6 at 114,671,097 bp
  • C to G, chromosome 6 at 116,698,349 bp
  • A to G, chromosome 6 at 125,308,068 bp
  • A to C, chromosome 6 at 131,659,384 bp
  • T to A, chromosome 6 at 142,103,100 bp
  • T to A, chromosome 6 at 149,327,878 bp
  • T to C, chromosome 7 at 17,090,396 bp
  • T to C, chromosome 7 at 27,971,641 bp
  • T to G, chromosome 7 at 29,002,396 bp
  • A to T, chromosome 7 at 73,417,320 bp
  • C to A, chromosome 7 at 143,069,318 bp
  • A to G, chromosome 8 at 44,953,046 bp
  • A to G, chromosome 8 at 70,756,448 bp
  • T to C, chromosome 8 at 94,392,526 bp
  • A to T, chromosome 9 at 38,657,777 bp
  • A to T, chromosome 9 at 42,071,201 bp
  • G to T, chromosome 9 at 122,259,564 bp
  • T to A, chromosome 10 at 21,621,659 bp
  • T to A, chromosome 10 at 62,973,294 bp
  • T to A, chromosome 10 at 92,868,734 bp
  • A to G, chromosome 11 at 60,492,992 bp
  • C to A, chromosome 11 at 78,231,800 bp
  • A to G, chromosome 11 at 116,684,387 bp
  • T to C, chromosome 12 at 112,765,051 bp
  • A to T, chromosome 13 at 51,419,439 bp
  • T to A, chromosome 13 at 83,625,406 bp
  • A to G, chromosome 14 at 50,127,231 bp
  • A to G, chromosome 14 at 55,864,478 bp
  • C to T, chromosome 16 at 59,328,598 bp
  • A to C, chromosome 17 at 28,810,659 bp
  • A to G, chromosome 17 at 30,986,299 bp
  • T to C, chromosome 17 at 32,797,842 bp
  • A to T, chromosome 18 at 37,341,906 bp
  • T to G, chromosome 18 at 37,444,775 bp
  • A to G, chromosome 19 at 29,026,227 bp
  • T to A, chromosome 19 at 30,993,084 bp
  • A to C, chromosome 19 at 41,614,870 bp
  • G to T, chromosome 19 at 42,201,827 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6702 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044820-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.