Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6702Btlr/Mmmh
Stock Number:
044820-MU
Citation ID:
RRID:MMRRC_044820-MU
Other Names:
R6702 (G1)
Major Collection:

Strain Information

Atg7
Name: autophagy related 7
Synonyms: 1810013K23Rik, Apg7l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74244
Homologene: 4662
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Ubap2
Name: ubiquitin-associated protein 2
Synonyms: 1190005K07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68926
Homologene: 73649
Csnk2a1
Name: casein kinase 2, alpha 1 polypeptide
Synonyms: Csnk2a1-rs4, CK2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12995
Homologene: 90874
S1pr3
Name: sphingosine-1-phosphate receptor 3
Synonyms: LPb3, S1P3, Edg3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13610
VEGA: 13
HGNC: HGNC:3167
Homologene: 3829
Mef2c
Name: myocyte enhancer factor 2C
Synonyms: 9930028G15Rik, 5430401D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17260
HGNC: HGNC:6996
Homologene: 31087
Ythdf1
Name: YTH N6-methyladenosine RNA binding protein 1
Synonyms: 2210410K23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228994
Homologene: 9844
Brpf3
Name: bromodomain and PHD finger containing, 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268936
Homologene: 16092
Ddx54
Name: DEAD box helicase 54
Synonyms: APR-5, DP97, 2410015A15Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71990
Homologene: 5590
Resf1
Name: retroelement silencing factor 1
Synonyms: GET, 2810474O19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Dlx2
Name: distal-less homeobox 2
Synonyms: Tes-1, DII A, Dlx-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13392
HGNC: HGNC:2915
Homologene: 3244
Sec23b
Name: SEC23 homolog B, COPII coat complex component
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27054
Homologene: 74571
Ano10
Name: anoctamin 10
Synonyms: Tmem16k
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102566
VEGA: 9
Homologene: 14314
Lamp5
Name: lysosomal-associated membrane protein family, member 5
Synonyms: 3110035N03Rik, BAD-LAMP, 6330527O06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76161
Homologene: 8173
Sfrp5
Name: secreted frizzled-related sequence protein 5
Synonyms: SARP3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54612
Homologene: 2268
Supt6
Name: SPT6, histone chaperone and transcription elongation factor
Synonyms: SPT6, 5131400N11Rik, Supt6h
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20926
Homologene: 40661
Ubr3
Name: ubiquitin protein ligase E3 component n-recognin 3
Synonyms: 4833421P10Rik, A130030D10Rik, 1110059H15Rik, Zfp650
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68795
Homologene: 52092
Casp2
Name: caspase 2
Synonyms: Ich-1, Caspase-2, Nedd2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12366
HGNC: HGNC:1503
Homologene: 7254
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Sorl1
Name: sortilin-related receptor, LDLR class A repeats-containing
Synonyms: LR11, mSorLA, 2900010L19Rik, Sorla
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20660
Homologene: 2336
Dna2
Name: DNA replication helicase/nuclease 2
Synonyms: E130315B21Rik, Dna2l
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 327762
HGNC: HGNC:2939
Homologene: 6124
St6galnac2
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Synonyms: ST6GalNAc II, Siat7, Siat7b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20446
Homologene: 4714
Prkg1
Name: protein kinase, cGMP-dependent, type I
Synonyms: Prkgr1b, Prkg1b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19091
HGNC: HGNC:9414
Homologene: 55964
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Ltbr
Name: lymphotoxin B receptor
Synonyms: TNFRrp, TNF receptor-related protein, LT-beta receptor, LT beta-R, Tnfbr, Ltar, TNF-R-III, TNFCR, TNFR2-RP, LTbetaR, Tnfrsf3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17000
HGNC: HGNC:6718
Homologene: 1753
Map4k1
Name: mitogen-activated protein kinase kinase kinase kinase 1
Synonyms: Hpk1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26411
HGNC: HGNC:6863
Homologene: 5199
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Slco1a6
Name: solute carrier organic anion transporter family, member 1a6
Synonyms: organic anion-transporting polypeptide, Oatp-5, 4930422F19Rik, Slc21a13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28254
Homologene: 23416
Nynrin
Name: NYN domain and retroviral integrase containing
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 277154
VEGA: 14
Homologene: 19483
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Per2
Name: period circadian clock 2
Synonyms: mPer2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18627
HGNC: HGNC:8846
Homologene: 7885
Trpm5
Name: transient receptor potential cation channel, subfamily M, member 5
Synonyms: Mtr1, Ltrpc5, 9430099A16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56843
Homologene: 22818
Pcdhb13
Name: protocadherin beta 13
Synonyms: PcdhbM, Pcdbh6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93884
HGNC: HGNC:8691
Homologene: 10338
Umodl1
Name: uromodulin-like 1
Synonyms: D17Ertd488e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52020
VEGA: 17
Homologene: 45466
Pld4
Name: phospholipase D family member 4
Synonyms: thss
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104759
VEGA: 12
Homologene: 16350
Or5ac23
Name: olfactory receptor family 5 subfamily AC member 23
Synonyms: GA_x54KRFPKG5P-55543875-55542958, MOR182-11P, Olfr205
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 257881
Homologene: 79469
Dnm3
Name: dynamin 3
Synonyms: B230343F03Rik, 9630020E24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 103967
Homologene: 22906
Cdcp2
Name: CUB domain containing protein 2
Synonyms: D030010E02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242603
Homologene: 138406
Ndor1
Name: NADPH dependent diflavin oxidoreductase 1
Synonyms: NR1, 4930447P04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78797
Homologene: 7144
Kif26b
Name: kinesin family member 26B
Synonyms: N-11 kinesin, D230039L06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269152
Homologene: 18623
Rgma
Name: repulsive guidance molecule family member A
Synonyms: RGM domain family, member A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244058
Homologene: 10626
Pcdhb7
Name: protocadherin beta 7
Synonyms: Pcdhb4B, PcdhbG
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93878
HGNC: HGNC:8689
Homologene: 87123
Ak3
Name: adenylate kinase 3
Synonyms: AK-3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56248
Homologene: 21744
Iqub
Name: IQ motif and ubiquitin domain containing
Synonyms: 4932408B21Rik, Trs4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214704
Homologene: 44790
Psg16
Name: pregnancy specific beta-1-glycoprotein 16
Synonyms: bCEA, Cea11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26436
Zfp780b
Name: zinc finger protein 780B
Synonyms: B230208L21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 338354
Homologene: 85969
Or8b51
Name: olfactory receptor family 8 subfamily B member 51
Synonyms: GA_x6K02T2PVTD-32360710-32359778, MOR168-1, Olfr916
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258780
VEGA: 9
Homologene: 74147
Rxrg
Name: retinoid X receptor gamma
Synonyms: Nr2b3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20183
Homologene: 21373
Or4k15
Name: olfactory receptor family 4 subfamily K member 15
Synonyms: GA_x6K02T2PMLR-5817082-5818056, MOR246-2, Olfr727
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258316
Homologene: 84571
Rab3a
Name: RAB3A, member RAS oncogene family
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19339
HGNC: HGNC:9777
Homologene: 20629
Or4k42
Name: olfactory receptor family 4 subfamily K member 42
Synonyms: GA_x6K02T2Q125-72541649-72540711, MOR248-9, Olfr1290
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257662
Homologene: 74248
Herpud1
Name: homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Synonyms: Herp, Mifl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64209
Homologene: 40973
Tas2r107
Name: taste receptor, type 2, member 107
Synonyms: T2R07, Tas2r7, T2R4, STC 5-1, mGR06, mt2r43
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387342
Homologene: 137369
Or5d46
Name: olfactory receptor family 5 subfamily D member 46
Synonyms: GA_x6K02T2Q125-49824309-49825256, MOR174-5, Olfr1176
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258767
Tmem72
Name: transmembrane protein 72
Synonyms: C230095G01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319776
Homologene: 18704
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, Gm872, 4930485B16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 90,779,439 bp
  • C to T, chromosome 1 at 91,427,949 bp
  • A to G, chromosome 1 at 162,318,687 bp
  • A to G, chromosome 1 at 167,613,805 bp
  • C to G, chromosome 1 at 178,917,287 bp
  • A to G, chromosome 2 at 25,249,890 bp
  • A to T, chromosome 2 at 69,956,049 bp
  • A to G, chromosome 2 at 71,546,227 bp
  • T to G, chromosome 2 at 76,720,112 bp
  • G to A, chromosome 2 at 88,340,242 bp
  • T to A, chromosome 2 at 111,490,109 bp
  • C to G, chromosome 2 at 136,059,563 bp
  • A to T, chromosome 2 at 144,559,189 bp
  • A to G, chromosome 2 at 152,258,688 bp
  • A to G, chromosome 2 at 180,919,133 bp
  • A to G, chromosome 3 at 56,005,502 bp
  • GCCCGCTTGCCCCGCT to GCCCGCTTGCCCCGCTTGCCCCGCT, chromosome 4 at 41,227,210 bp
  • T to C, chromosome 4 at 107,107,086 bp
  • C to T, chromosome 5 at 115,551,896 bp
  • T to A, chromosome 5 at 120,626,503 bp
  • A to G, chromosome 5 at 124,805,805 bp
  • GC to GCTCC, chromosome 6 at 4,756,452 bp
  • T to A, chromosome 6 at 24,449,745 bp
  • T to C, chromosome 6 at 42,268,051 bp
  • C to A, chromosome 6 at 114,671,097 bp
  • C to G, chromosome 6 at 116,698,349 bp
  • A to G, chromosome 6 at 125,308,068 bp
  • A to C, chromosome 6 at 131,659,384 bp
  • T to A, chromosome 6 at 142,103,100 bp
  • T to A, chromosome 6 at 149,327,878 bp
  • T to C, chromosome 7 at 17,090,396 bp
  • T to C, chromosome 7 at 27,971,641 bp
  • T to G, chromosome 7 at 29,002,396 bp
  • A to T, chromosome 7 at 73,417,320 bp
  • C to A, chromosome 7 at 143,069,318 bp
  • A to G, chromosome 8 at 44,953,046 bp
  • A to G, chromosome 8 at 70,756,448 bp
  • T to C, chromosome 8 at 94,392,526 bp
  • A to T, chromosome 9 at 38,657,777 bp
  • A to T, chromosome 9 at 42,071,201 bp
  • G to T, chromosome 9 at 122,259,564 bp
  • T to A, chromosome 10 at 21,621,659 bp
  • T to A, chromosome 10 at 62,973,294 bp
  • T to A, chromosome 10 at 92,868,734 bp
  • A to G, chromosome 11 at 60,492,992 bp
  • C to A, chromosome 11 at 78,231,800 bp
  • A to G, chromosome 11 at 116,684,387 bp
  • T to C, chromosome 12 at 112,765,051 bp
  • A to T, chromosome 13 at 51,419,439 bp
  • T to A, chromosome 13 at 83,625,406 bp
  • A to G, chromosome 14 at 50,127,231 bp
  • A to G, chromosome 14 at 55,864,478 bp
  • C to T, chromosome 16 at 59,328,598 bp
  • A to C, chromosome 17 at 28,810,659 bp
  • A to G, chromosome 17 at 30,986,299 bp
  • T to C, chromosome 17 at 32,797,842 bp
  • A to T, chromosome 18 at 37,341,906 bp
  • T to G, chromosome 18 at 37,444,775 bp
  • A to G, chromosome 19 at 29,026,227 bp
  • T to A, chromosome 19 at 30,993,084 bp
  • A to C, chromosome 19 at 41,614,870 bp
  • G to T, chromosome 19 at 42,201,827 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6702 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044820-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.