Strain Name:
C57BL/6J-MtgxR6794Btlr/Mmmh
Stock Number:
044907-MU
Citation ID:
RRID:MMRRC_044907-MU
Other Names:
R6794 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Gabrg1
Name: gamma-aminobutyric acid type A receptor subunit gamma 1
Synonyms: GabaA
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14405
HGNC: HGNC:4086
Homologene: 22570
Kmt2e
Name: lysine (K)-specific methyltransferase 2E
Synonyms: Mll5, 9530077A04Rik, D230038D11Rik, 1810033J14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69188
Homologene: 18822
Ylpm1
Name: YLP motif containing 1
Synonyms: Zap3, A930013E17Rik, ZAP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56531
Homologene: 87707
Bltp3b
Name: bridge-like lipid transfer protein family member 3B
Synonyms: 4930506D01Rik, Uhrf1bp1l, 2010319N22Rik, E030041M21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75089
VEGA: 10
Homologene: 12590
Mdn1
Name: midasin AAA ATPase 1
Synonyms: 4833432B22Rik, LOC213784, D4Abb1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Thbs1
Name: thrombospondin 1
Synonyms: tbsp1, TSP-1, TSP1, Thbs-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21825
Homologene: 31142
Atf7
Name: activating transcription factor 7
Synonyms: 1110012F10Rik, C130020M04Rik, 9430065F09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223922
HGNC: HGNC:792
Homologene: 4994
Jph3
Name: junctophilin 3
Synonyms: JP-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 57340
Homologene: 10762
Prim1
Name: DNA primase, p49 subunit
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19075
HGNC: HGNC:9369
Homologene: 730
Cyc1
Name: cytochrome c-1
Synonyms: 2610002H19Rik, Cyct1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66445
VEGA: 15
HGNC: HGNC:2579
Homologene: 55617
Lnpep
Name: leucyl/cystinyl aminopeptidase
Synonyms: 4732490P18Rik, 2010309L07Rik, gp160, vp165, IRAP
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240028
VEGA: 17
HGNC: HGNC:6656
Homologene: 21148
Ptpn4
Name: protein tyrosine phosphatase, non-receptor type 4
Synonyms: testis-enriched phosphatase, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte), TEP/mPTPMEG, TEP, PTPMEG, hPTP-MEG
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19258
HGNC: HGNC:9656
Homologene: 2120
Shf
Name: Src homology 2 domain containing F
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 435684
Homologene: 44524
Nfkb2
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
Synonyms: NF kappaB2, p52
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18034
VEGA: 19
HGNC: HGNC:7795
Homologene: 1873
Dock8
Name: dedicator of cytokinesis 8
Synonyms: 1200017A24Rik, 5830472H07Rik, A130095G14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76088
VEGA: 19
Homologene: 52414
Ddr2
Name: discoidin domain receptor family, member 2
Synonyms: Ntrkr3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18214
HGNC: HGNC:2731
Homologene: 68505
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Slc22a29
Name: solute carrier family 22. member 29
Synonyms: D630002G06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 236293
Homologene: 77136
Cracdl
Name: capping protein inhibiting regulator of actin like
Synonyms: 2010300C02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72097
Homologene: 19208
Pik3r2
Name: phosphoinositide-3-kinase regulatory subunit 2
Synonyms: p85beta
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18709
HGNC: HGNC:8980
Homologene: 3687
Scn5a
Name: sodium channel, voltage-gated, type V, alpha
Synonyms: Nav1.5, mH1, SkM2, Nav1.5c
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20271
Homologene: 22738
Xpc
Name: xeroderma pigmentosum, complementation group C
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22591
Homologene: 3401
Ubqlnl
Name: ubiquilin-like
Synonyms: 4922504M18Rik, LOC244179
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244179
Homologene: 17034
Serac1
Name: serine active site containing 1
Synonyms: 4930511N22Rik, D17Ertd141e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 321007
Homologene: 41900
Vmn2r72
Name: vomeronasal 2, receptor 72
Synonyms: EG244114, Vmn2r72-ps
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244114
Homologene: 115466
Ica1
Name: islet cell autoantigen 1
Synonyms: ICA69, 69kDa
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15893
HGNC: HGNC:5343
Homologene: 7777
Vmn2r118
Name: vomeronasal 2, receptor 118
Synonyms: EG383258, Vmn2r119, EG668547
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 383258
Homologene: 129687
Disc1
Name: disrupted in schizophrenia 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244667
HGNC: HGNC:2888
Homologene: 10257
H2-Ob
Name: histocompatibility 2, O region beta locus
Synonyms: H2-IAb2, H2-Ab, H2-Ab2, H-2Ob, A-beta-2, A-beta2, H-2I, Ob, vic1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15002
HGNC: HGNC:4937
Homologene: 1602
Agxt
Name: alanine-glyoxylate aminotransferase
Synonyms: Agxt1, Agt1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11611
HGNC: HGNC:341
Homologene: 37251
Dcaf5
Name: DDB1 and CUL4 associated factor 5
Synonyms: 9430020B07Rik, BCRP2, Wdr22, BCRG2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320808
VEGA: 12
Homologene: 18564
Herpud1
Name: homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Synonyms: Herp, Mifl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64209
Homologene: 40973
Sapcd2
Name: suppressor APC domain containing 2
Synonyms: 2010317E24Rik, ang, 6030458L21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72080
Homologene: 18664
Btg4
Name: BTG anti-proliferation factor 4
Synonyms: PC3B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56057
VEGA: 9
Homologene: 9734
Prokr1
Name: prokineticin receptor 1
Synonyms: Pkr1, EG-VEGFR1, Gpr73
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58182
HGNC: HGNC:4524
Homologene: 10968
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 37,637,855 bp
  • T to C, chromosome 1 at 93,135,382 bp
  • T to C, chromosome 1 at 119,743,390 bp
  • C to A, chromosome 1 at 169,982,098 bp
  • A to G, chromosome 2 at 25,376,367 bp
  • A to G, chromosome 2 at 118,120,038 bp
  • A to G, chromosome 2 at 122,353,840 bp
  • A to T, chromosome 2 at 177,387,838 bp
  • T to A, chromosome 4 at 32,741,893 bp
  • TGCCGCCGCCGCCGCCACCGCCGCCGCCGC to TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC, chromosome 5 at 23,499,476 bp
  • C to T, chromosome 5 at 70,815,971 bp
  • T to C, chromosome 6 at 8,653,659 bp
  • T to C, chromosome 6 at 87,588,693 bp
  • G to A, chromosome 6 at 91,506,857 bp
  • A to G, chromosome 7 at 85,737,996 bp
  • C to T, chromosome 7 at 104,148,785 bp
  • T to C, chromosome 7 at 141,809,552 bp
  • T to C, chromosome 8 at 70,770,717 bp
  • T to A, chromosome 8 at 94,394,770 bp
  • T to C, chromosome 8 at 121,785,385 bp
  • T to C, chromosome 8 at 125,087,775 bp
  • A to C, chromosome 9 at 51,119,351 bp
  • T to C, chromosome 9 at 67,286,558 bp
  • T to C, chromosome 9 at 119,535,889 bp
  • T to C, chromosome 10 at 89,805,762 bp
  • T to C, chromosome 10 at 128,018,149 bp
  • A to T, chromosome 12 at 80,398,893 bp
  • A to G, chromosome 12 at 84,996,881 bp
  • A to G, chromosome 15 at 76,344,650 bp
  • T to C, chromosome 15 at 102,557,465 bp
  • A to G, chromosome 17 at 6,051,710 bp
  • T to G, chromosome 17 at 17,531,159 bp
  • T to A, chromosome 17 at 34,241,188 bp
  • T to A, chromosome 17 at 55,592,348 bp
  • G to T, chromosome 19 at 8,161,523 bp
  • A to G, chromosome 19 at 25,122,441 bp
  • T to C, chromosome 19 at 46,307,720 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6794 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044907-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.