Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6817Btlr/Mmmh
Stock Number:
044929-MU
Citation ID:
RRID:MMRRC_044929-MU
Other Names:
R6817 (G1)
Major Collection:

Strain Information

Epha2
Name: Eph receptor A2
Synonyms: Sek-2, Eck, Sek2, Myk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13836
HGNC: HGNC:3386
Homologene: 20929
Nos2
Name: nitric oxide synthase 2, inducible
Synonyms: iNOS, Nos-2, NOS-II, Nos2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18126
HGNC: HGNC:7873
Homologene: 55473
Ddc
Name: dopa decarboxylase
Synonyms: aromatic L-amino acid decarboxylase, Aadc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13195
HGNC: HGNC:2719
Homologene: 618
Pkp4
Name: plakophilin 4
Synonyms: p0071, Armrp, 5031422I09Rik, 9430019K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227937
HGNC: HGNC:9026
Homologene: 2689
Lrrc59
Name: leucine rich repeat containing 59
Synonyms: C78668
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 98238
Homologene: 10229
Lrrc41
Name: leucine rich repeat containing 41
Synonyms: D730026A16Rik, MUF1, D630045E04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230654
Homologene: 4645
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 10,030,604 bp
  • G to A, chromosome 1 at 37,449,123 bp
  • A to G, chromosome 1 at 140,246,193 bp
  • A to G, chromosome 1 at 167,078,850 bp
  • A to T, chromosome 1 at 188,862,864 bp
  • T to G, chromosome 1 at 191,063,274 bp
  • A to C, chromosome 2 at 20,880,296 bp
  • T to C, chromosome 2 at 59,318,600 bp
  • A to T, chromosome 2 at 88,322,763 bp
  • T to C, chromosome 2 at 128,596,510 bp
  • A to G, chromosome 3 at 10,340,824 bp
  • A to G, chromosome 4 at 11,357,552 bp
  • A to G, chromosome 4 at 104,679,546 bp
  • C to T, chromosome 4 at 106,714,115 bp
  • G to A, chromosome 4 at 116,089,305 bp
  • A to G, chromosome 4 at 141,308,994 bp
  • C to T, chromosome 5 at 53,064,028 bp
  • C to T, chromosome 5 at 86,556,934 bp
  • T to A, chromosome 5 at 112,830,238 bp
  • T to C, chromosome 5 at 136,373,173 bp
  • T to A, chromosome 6 at 41,658,007 bp
  • A to C, chromosome 7 at 18,814,640 bp
  • A to G, chromosome 7 at 83,987,992 bp
  • T to G, chromosome 7 at 91,965,664 bp
  • A to G, chromosome 7 at 97,957,830 bp
  • A to G, chromosome 7 at 141,217,447 bp
  • T to A, chromosome 7 at 141,651,061 bp
  • T to C, chromosome 7 at 141,862,913 bp
  • T to C, chromosome 8 at 94,314,682 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 9 at 78,714,955 bp
  • G to A, chromosome 9 at 108,092,679 bp
  • T to C, chromosome 10 at 18,174,059 bp
  • GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT to GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT, chromosome 10 at 116,283,677 bp
  • A to G, chromosome 11 at 11,824,854 bp
  • A to G, chromosome 11 at 66,925,911 bp
  • A to G, chromosome 11 at 68,486,581 bp
  • A to T, chromosome 11 at 78,945,266 bp
  • T to C, chromosome 11 at 87,809,241 bp
  • G to C, chromosome 11 at 94,630,065 bp
  • T to C, chromosome 11 at 119,462,285 bp
  • T to C, chromosome 12 at 69,618,161 bp
  • T to C, chromosome 13 at 74,699,158 bp
  • C to A, chromosome 13 at 94,997,304 bp
  • T to C, chromosome 14 at 51,573,021 bp
  • A to T, chromosome 18 at 20,394,405 bp
  • A to G, chromosome 18 at 22,523,580 bp
  • T to G, chromosome 19 at 9,283,497 bp
  • T to A, chromosome 19 at 47,756,085 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6817 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044929-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.