Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6817Btlr/Mmmh
Stock Number:
044929-MU
Citation ID:
RRID:MMRRC_044929-MU
Other Names:
R6817 (G1)
Major Collection:

Strain Information

Epha2
Name: Eph receptor A2
Synonyms: Sek-2, Eck, Sek2, Myk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13836
HGNC: HGNC:3386
Homologene: 20929
Nos2
Name: nitric oxide synthase 2, inducible
Synonyms: iNOS, Nos-2, NOS-II, Nos2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18126
HGNC: HGNC:7873
Homologene: 55473
Ddc
Name: dopa decarboxylase
Synonyms: aromatic L-amino acid decarboxylase, Aadc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13195
HGNC: HGNC:2719
Homologene: 618
Pkp4
Name: plakophilin 4
Synonyms: p0071, Armrp, 5031422I09Rik, 9430019K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227937
HGNC: HGNC:9026
Homologene: 2689
Lrrc59
Name: leucine rich repeat containing 59
Synonyms: C78668
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 98238
Homologene: 10229
Lrrc41
Name: leucine rich repeat containing 41
Synonyms: D730026A16Rik, MUF1, D630045E04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230654
Homologene: 4645
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Nup93
Name: nucleoporin 93
Synonyms: 2410008G02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71805
Homologene: 40971
Cux1
Name: cut-like homeobox 1
Synonyms: Cux, CDP, Cux-1, Cutl1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13047
HGNC: HGNC:2557
Dab1
Name: disabled 1
Synonyms: C630028C02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13131
HGNC: HGNC:2661
Homologene: 32084
Mgat4a
Name: mannoside acetylglucosaminyltransferase 4, isoenzyme A
Synonyms: GnT-IVa, 9530018I07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269181
HGNC: HGNC:7047
Homologene: 8153
Cemip
Name: cell migration inducing protein, hyaluronan binding
Synonyms: 12H19.01.T7, 6330404C01Rik, 9930013L23Rik, Hybid
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80982
Homologene: 10268
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: LOC381127, D930044O18Rik, D430002O22Rik, C230079D11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211961
Homologene: 19371
Nsl1
Name: NSL1, MIS12 kinetochore complex component
Synonyms: LOC381318, 4833432M17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381318
Homologene: 22898
Esrp1
Name: epithelial splicing regulatory protein 1
Synonyms: 2210008M09Rik, Rbm35a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 207920
Homologene: 9785
Pirt
Name: phosphoinositide-interacting regulator of transient receptor potential channels
Synonyms: Pirt, A530088H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193003
Homologene: 77645
Trpv5
Name: transient receptor potential cation channel, subfamily V, member 5
Synonyms: CaT2, ECaC1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194352
HGNC: HGNC:3145
Homologene: 10520
Apeh
Name: acylpeptide hydrolase
Synonyms: N-acylaminoacyl peptide hydrolase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235606
HGNC: HGNC:586
Homologene: 1240
Mroh7
Name: maestro heat-like repeat family member 7
Synonyms: LOC381538, Gm1027, Heatr8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381538
Homologene: 19633
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 672511
Homologene: 45439
Gdpd4
Name: glycerophosphodiester phosphodiesterase domain containing 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233537
Homologene: 18606
Ect2l
Name: epithelial cell transforming sequence 2 oncogene-like
Synonyms: Gm10331, C330021H03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100045792
Homologene: 46005
Sos2
Name: SOS Ras/Rho guanine nucleotide exchange factor 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20663
Homologene: 38253
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Wdr41
Name: WD repeat domain 41
Synonyms: MSTP048, B830029I03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218460
Homologene: 23087
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Pik3r5
Name: phosphoinositide-3-kinase regulatory subunit 5
Synonyms: Foap2, p101
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320207
Homologene: 8627
Dsg1b
Name: desmoglein 1 beta
Synonyms: Dsg5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225256
HGNC: HGNC:3048
Homologene: 1463
Slc34a2
Name: solute carrier family 34 (sodium phosphate), member 2
Synonyms: type IIb Na/Picotransporter, Npt2b, NaPi-2b, D5Ertd227e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20531
Homologene: 2297
Tmprss11f
Name: transmembrane protease, serine 11f
Synonyms: 4732406D01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243083
Homologene: 65356
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240776
Homologene: 16121
Cfap43
Name: cilia and flagella associated protein 43
Synonyms: 4930428C11Rik, 4632415N18Rik, 4930463G05Rik, D19Ertd652e, Wdr96
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100048534
Homologene: 36425
Myo18b
Name: myosin XVIIIb
Synonyms: 4932408L24Rik, 4933411E19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74376
Homologene: 53435
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: 3230402H02Rik, VE-PTP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Zfand1
Name: zinc finger, AN1-type domain 1
Synonyms: 2310008M20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66361
Homologene: 6779
Rassf7
Name: Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
Synonyms: 2400009B11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66985
HGNC: HGNC:1166
Homologene: 2595
Dlg2
Name: discs large MAGUK scaffold protein 2
Synonyms: PSD93, Chapsyn-110, B330007M19Rik, A330103J02Rik, LOC382816, Dlgh2, B230218P12Rik, Gm21505
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23859
HGNC: HGNC:2901
Homologene: 1046
Lpo
Name: lactoperoxidase
Synonyms: 5830499B15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76113
HGNC: HGNC:6678
Homologene: 21240
Psg17
Name: pregnancy specific beta-1-glycoprotein 17
Synonyms: mmCGM5, Cea-2, Cea2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26437
Homologene: 110989
Fam78b
Name: family with sequence similarity 78, member B
Synonyms: C030020L09Rik, C030014K22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226610
Homologene: 18451
Cops5
Name: COP9 signalosome subunit 5
Synonyms: Sgn5, JUN activation binding protein, Jab1, COP9 complex S5, CSN5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26754
HGNC: HGNC:2240
Homologene: 55992
Spdye4c
Name: speedy/RINGO cell cycle regulator family, member E4C
Synonyms: LOC241634, Gm355
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241634
Homologene: 78093
Pcna-ps2
Name: proliferating cell nuclear antigen pseudogene 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18540
VEGA: 19
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Or5d45
Name: olfactory receptor family 5 subfamily D member 45
Synonyms: GA_x6K02T2Q125-49808415-49807477, MOR174-15P, Olfr1175, Olfr1175-ps
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 546770
HGNC: HGNC:8336
Homologene: 77381
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 10,030,604 bp
  • G to A, chromosome 1 at 37,449,123 bp
  • A to G, chromosome 1 at 140,246,193 bp
  • A to G, chromosome 1 at 167,078,850 bp
  • A to T, chromosome 1 at 188,862,864 bp
  • T to G, chromosome 1 at 191,063,274 bp
  • A to C, chromosome 2 at 20,880,296 bp
  • T to C, chromosome 2 at 59,318,600 bp
  • A to T, chromosome 2 at 88,322,763 bp
  • T to C, chromosome 2 at 128,596,510 bp
  • A to G, chromosome 3 at 10,340,824 bp
  • A to G, chromosome 4 at 11,357,552 bp
  • A to G, chromosome 4 at 104,679,546 bp
  • C to T, chromosome 4 at 106,714,115 bp
  • G to A, chromosome 4 at 116,089,305 bp
  • A to G, chromosome 4 at 141,308,994 bp
  • C to T, chromosome 5 at 53,064,028 bp
  • C to T, chromosome 5 at 86,556,934 bp
  • T to A, chromosome 5 at 112,830,238 bp
  • T to C, chromosome 5 at 136,373,173 bp
  • T to A, chromosome 6 at 41,658,007 bp
  • A to C, chromosome 7 at 18,814,640 bp
  • A to G, chromosome 7 at 83,987,992 bp
  • T to G, chromosome 7 at 91,965,664 bp
  • A to G, chromosome 7 at 97,957,830 bp
  • A to G, chromosome 7 at 141,217,447 bp
  • T to A, chromosome 7 at 141,651,061 bp
  • T to C, chromosome 7 at 141,862,913 bp
  • T to C, chromosome 8 at 94,314,682 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 9 at 78,714,955 bp
  • G to A, chromosome 9 at 108,092,679 bp
  • T to C, chromosome 10 at 18,174,059 bp
  • GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT to GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT, chromosome 10 at 116,283,677 bp
  • A to G, chromosome 11 at 11,824,854 bp
  • A to G, chromosome 11 at 66,925,911 bp
  • A to G, chromosome 11 at 68,486,581 bp
  • A to T, chromosome 11 at 78,945,266 bp
  • T to C, chromosome 11 at 87,809,241 bp
  • G to C, chromosome 11 at 94,630,065 bp
  • T to C, chromosome 11 at 119,462,285 bp
  • T to C, chromosome 12 at 69,618,161 bp
  • T to C, chromosome 13 at 74,699,158 bp
  • C to A, chromosome 13 at 94,997,304 bp
  • T to C, chromosome 14 at 51,573,021 bp
  • A to T, chromosome 18 at 20,394,405 bp
  • A to G, chromosome 18 at 22,523,580 bp
  • T to G, chromosome 19 at 9,283,497 bp
  • T to A, chromosome 19 at 47,756,085 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6817 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044929-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.