Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6823Btlr/Mmmh
Stock Number:
044935-MU
Citation ID:
RRID:MMRRC_044935-MU
Other Names:
R6823 (G1)
Major Collection:

Strain Information

Kit
Name: Kit proto-oncogene receptor tyrosine kinase
Synonyms: Steel Factor Receptor, c-KIT, Dominant white spotting, belly-spot, Tr-kit, SOW3, SCO5, SCO1, Gsfsow3, Gsfsco5, Gsfsco1, CD117
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Aggf1
Name: angiogenic factor with G patch and FHA domains 1
Synonyms: 2310029P06Rik, VG5Q, 2010009L17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66549
Homologene: 41220
Zdhhc17
Name: zinc finger, DHHC domain containing 17
Synonyms: A230053P19Rik, D130071N24Rik, Hip14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320150
VEGA: 10
Homologene: 56324
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Phf12
Name: PHD finger protein 12
Synonyms: PF1, 2410142K10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268448
Homologene: 10841
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 36,268,704 bp
  • A to T, chromosome 1 at 53,456,704 bp
  • A to G, chromosome 1 at 135,325,167 bp
  • A to T, chromosome 1 at 180,960,470 bp
  • T to C, chromosome 1 at 192,505,289 bp
  • T to A, chromosome 2 at 13,445,029 bp
  • T to C, chromosome 2 at 25,409,109 bp
  • A to G, chromosome 2 at 155,981,459 bp
  • C to A, chromosome 2 at 170,487,979 bp
  • T to A, chromosome 3 at 38,983,939 bp
  • G to C, chromosome 3 at 84,958,627 bp
  • A to T, chromosome 3 at 107,311,498 bp
  • C to A, chromosome 3 at 154,727,437 bp
  • A to G, chromosome 4 at 56,787,939 bp
  • A to T, chromosome 4 at 136,227,572 bp
  • T to A, chromosome 5 at 14,677,907 bp
  • A to G, chromosome 5 at 69,517,070 bp
  • A to T, chromosome 5 at 73,065,217 bp
  • C to A, chromosome 5 at 75,652,649 bp
  • A to T, chromosome 5 at 107,149,914 bp
  • CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC to CATC, chromosome 6 at 4,756,431 bp
  • A to T, chromosome 6 at 38,919,153 bp
  • G to A, chromosome 6 at 87,981,302 bp
  • T to C, chromosome 6 at 140,525,858 bp
  • T to C, chromosome 7 at 4,122,529 bp
  • A to T, chromosome 7 at 27,034,156 bp
  • C to T, chromosome 7 at 27,535,897 bp
  • G to C, chromosome 7 at 30,989,290 bp
  • A to G, chromosome 7 at 41,649,560 bp
  • A to T, chromosome 7 at 43,694,456 bp
  • GGCG to GGCGACGGCCGCG, chromosome 7 at 97,579,906 bp
  • G to A, chromosome 7 at 102,614,486 bp
  • A to G, chromosome 7 at 110,281,303 bp
  • A to G, chromosome 8 at 4,267,282 bp
  • A to T, chromosome 8 at 48,256,837 bp
  • T to C, chromosome 8 at 70,181,199 bp
  • T to A, chromosome 8 at 109,530,307 bp
  • T to A, chromosome 8 at 111,459,040 bp
  • T to C, chromosome 8 at 123,356,727 bp
  • C to G, chromosome 8 at 124,324,011 bp
  • T to C, chromosome 9 at 38,594,905 bp
  • G to T, chromosome 9 at 54,549,891 bp
  • T to C, chromosome 9 at 83,953,761 bp
  • T to C, chromosome 9 at 88,394,382 bp
  • A to G, chromosome 9 at 124,439,078 bp
  • A to T, chromosome 10 at 61,667,603 bp
  • G to A, chromosome 10 at 68,026,632 bp
  • T to C, chromosome 10 at 110,955,111 bp
  • T to A, chromosome 10 at 115,174,106 bp
  • A to C, chromosome 10 at 120,476,024 bp
  • T to C, chromosome 11 at 4,136,609 bp
  • C to A, chromosome 11 at 30,114,787 bp
  • C to T, chromosome 11 at 59,067,943 bp
  • T to C, chromosome 11 at 67,356,158 bp
  • T to A, chromosome 11 at 69,825,924 bp
  • T to C, chromosome 11 at 74,239,696 bp
  • C to T, chromosome 11 at 78,022,511 bp
  • C to T, chromosome 11 at 96,318,654 bp
  • T to C, chromosome 11 at 116,086,910 bp
  • C to G, chromosome 12 at 71,317,939 bp
  • A to T, chromosome 13 at 48,490,996 bp
  • A to G, chromosome 13 at 81,557,081 bp
  • T to C, chromosome 13 at 95,364,723 bp
  • T to C, chromosome 14 at 16,443,824 bp
  • A to T, chromosome 14 at 31,084,790 bp
  • A to T, chromosome 14 at 34,094,765 bp
  • A to T, chromosome 14 at 70,565,374 bp
  • T to C, chromosome 15 at 37,989,598 bp
  • T to G, chromosome 15 at 64,754,886 bp
  • C to T, chromosome 15 at 75,969,723 bp
  • T to C, chromosome 15 at 76,119,746 bp
  • T to G, chromosome 16 at 5,064,547 bp
  • T to A, chromosome 16 at 20,734,736 bp
  • A to T, chromosome 16 at 93,755,485 bp
  • T to C, chromosome 17 at 32,360,421 bp
  • A to T, chromosome 17 at 34,958,185 bp
  • C to A, chromosome 17 at 57,105,513 bp
  • T to A, chromosome 18 at 37,876,383 bp
  • A to G, chromosome 18 at 38,847,108 bp
  • A to T, chromosome 18 at 67,648,857 bp
  • A to T, chromosome 19 at 7,639,496 bp
  • T to A, chromosome 19 at 10,532,884 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6823 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044935-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.