Strain Name:
C57BL/6J-MtgxR6823Btlr/Mmmh
Stock Number:
044935-MU
Citation ID:
RRID:MMRRC_044935-MU
Other Names:
R6823 (G1)
Major Collection:

Strain Information

Kit
Name: KIT proto-oncogene receptor tyrosine kinase
Synonyms: Steel Factor Receptor, c-KIT, Dominant white spotting, belly-spot, Tr-kit, SOW3, SCO5, SCO1, Gsfsow3, Gsfsco5, Gsfsco1, CD117
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Aggf1
Name: angiogenic factor with G patch and FHA domains 1
Synonyms: 2310029P06Rik, VG5Q, 2010009L17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66549
Homologene: 41220
Zdhhc17
Name: zinc finger, DHHC domain containing 17
Synonyms: D130071N24Rik, A230053P19Rik, Hip14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320150
VEGA: 10
Homologene: 56324
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Phf12
Name: PHD finger protein 12
Synonyms: PF1, 2410142K10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268448
Homologene: 10841
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Fgf1
Name: fibroblast growth factor 1
Synonyms: fibroblast growth factor 1 (acidic), Fgf-1, Fgfa
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14164
HGNC: HGNC:3665
Homologene: 625
Wdr59
Name: WD repeat domain 59
Synonyms: 5430401O09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319481
Homologene: 38685
Diaph1
Name: diaphanous related formin 1
Synonyms: p140mDia, Drf1, Dia1, D18Wsu154e, mDia1, Diap1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13367
HGNC: HGNC:2876
Homologene: 129567
Swap70
Name: SWA-70 protein
Synonyms: 70kDa
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20947
Homologene: 7557
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Plekha5
Name: pleckstrin homology domain containing, family A member 5
Synonyms: PEPP2, 2810431N21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109135
Homologene: 10377
Elp1
Name: elongator complex protein 1
Synonyms: 3110040G09Rik, C78473, IKAP, Ikbkap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230233
HGNC: HGNC:5959
Homologene: 2699
Rarb
Name: retinoic acid receptor, beta
Synonyms: RARbeta2, RAR beta 2, Hap
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218772
VEGA: 14
HGNC: HGNC:9865
Homologene: 68100
Dact1
Name: dishevelled-binding antagonist of beta-catenin 1
Synonyms: THYEX3, Frd1, Frodo, Frodo1, Dapper1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 59036
Homologene: 9613
Ubn1
Name: ubinuclein 1
Synonyms: 1110029L11Rik, 2610108L02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 170644
VEGA: 16
Homologene: 9656
Cpsf7
Name: cleavage and polyadenylation specific factor 7
Synonyms: C330017N18Rik, 5730453I16Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 269061
VEGA: 19
Homologene: 11731
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Pld3
Name: phospholipase D family member 3
Synonyms: Sam-9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18807
Homologene: 7893
Hr
Name: lysine demethylase and nuclear receptor corepressor
Synonyms: N, ba, rh, rh-bmh, bldy
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 15460
HGNC: HGNC:5172
Homologene: 3774
Psmg2
Name: proteasome (prosome, macropain) assembly chaperone 2
Synonyms: 1700017I17Rik, Clast3, Tnfsf5ip1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107047
VEGA: 18
Homologene: 41354
Tph2
Name: tryptophan hydroxylase 2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216343
Homologene: 27831
Ppa1
Name: pyrophosphatase (inorganic) 1
Synonyms: 2010317E03Rik, Pyp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67895
HGNC: HGNC:9226
Homologene: 5356
Wbp2
Name: WW domain binding protein 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22378
Homologene: 32160
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, 2610100B16Rik, Odz3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Zfp169
Name: zinc finger protein 169
Synonyms: 4930429A13Rik, 1700025J14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67911
Homologene: 2572
Pbrm1
Name: polybromo 1
Synonyms: BAF180, 2610016F04Rik, 2310032M22Rik, Pb1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66923
Homologene: 10044
Asap3
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Synonyms: UPLC1, 9430088F20Rik, Ddefl1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230837
Homologene: 41190
Ttyh1
Name: tweety family member 1
Synonyms: tty, 6330408P11Rik, 4930459B04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57776
Homologene: 10779
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Hspa1b
Name: heat shock protein 1B
Synonyms: hsp68, Hsp70.1, Hsp70-1, HSP70B1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15511
HGNC: HGNC:5233
Homologene: 133785
Slc16a4
Name: solute carrier family 16 (monocarboxylic acid transporters), member 4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229699
Homologene: 74529
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Galnt2
Name: polypeptide N-acetylgalactosaminyltransferase 2
Synonyms: ppGaNTase-T2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108148
HGNC: HGNC:4124
Homologene: 3297
Nlgn2
Name: neuroligin 2
Synonyms: NL2, NLG2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216856
Homologene: 69317
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: extraocular myosin, EO Myosin, MyHC-eo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Tnfsf9
Name: tumor necrosis factor (ligand) superfamily, member 9
Synonyms: 4-1BB ligand, Ly63l, Cd137l, 4-1BB-L, 4-1BBL
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21950
VEGA: 17
Homologene: 137221
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Chrd
Name: chordin
Synonyms: Chd
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12667
HGNC: HGNC:1949
Homologene: 2774
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
BC024139
Name: cDNA sequence BC024139
Synonyms: 6230424I18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 271278
Homologene: 129974
Pmfbp1
Name: polyamine modulated factor 1 binding protein 1
Synonyms: F77, 1700016D22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56523
Homologene: 23182
Tmem63a
Name: transmembrane protein 63a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208795
Homologene: 101673
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Adcy8
Name: adenylate cyclase 8
Synonyms: AC8
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11514
VEGA: 15
HGNC: HGNC:239
Homologene: 37443
Fbxw7
Name: F-box and WD-40 domain protein 7
Synonyms: SEL-10, AGO, Fbxo30, Fbxw6, 1110001A17Rik, Cdc4, Fbw7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 50754
Homologene: 117451
Anxa8
Name: annexin A8
Synonyms: Anx8
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11752
Homologene: 20393
Spire2
Name: spire type actin nucleation factor 2
Synonyms: Spir-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234857
Homologene: 72212
Tgfbr3
Name: transforming growth factor, beta receptor III
Synonyms: betaglycan, TBRIII, 1110036H20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21814
Homologene: 2436
Fam187b
Name: family with sequence similarity 187, member B
Synonyms: 1700020B09Rik, Tmem162
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76415
Homologene: 138431
Snx14
Name: sorting nexin 14
Synonyms: YR-14, C330035N22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244962
Homologene: 17823
Wiz
Name: widely-interspaced zinc finger motifs
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22404
Homologene: 7997
Zfp788
Name: zinc finger protein 788
Synonyms: 2810426N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67607
Homologene: 137363
Kcnh1
Name: potassium voltage-gated channel, subfamily H (eag-related), member 1
Synonyms: ether a go-go, Eag1, Kv10.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16510
HGNC: HGNC:6250
Homologene: 68242
Tbxas1
Name: thromboxane A synthase 1, platelet
Synonyms: TXS, CYP5A1, CYP5, TXAS
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21391
Homologene: 130979
Klk14
Name: kallikrein related-peptidase 14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317653
HGNC: HGNC:6362
Homologene: 69348
Rnf215
Name: ring finger protein 215
Synonyms: 0610009J22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71673
Homologene: 12402
Plaat5
Name: phospholipase A and acyltransferase 5
Synonyms: 1700086E08Rik, 1700055A14Rik, 4921526K24Rik, iNAT, Hrasls5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66727
Homologene: 12019
Cyp24a1
Name: cytochrome P450, family 24, subfamily a, polypeptide 1
Synonyms: 25-hydroxyvitamin D-24-hydroxylase, 24-OHase, Cyp24, CP24
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13081
HGNC: HGNC:2602
Homologene: 68094
Cep250
Name: centrosomal protein 250
Synonyms: Inmp, B230210E21Rik, Cep2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16328
HGNC: HGNC:1859
Homologene: 38286
Tmem161a
Name: transmembrane protein 161A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234371
Homologene: 9853
Timm44
Name: translocase of inner mitochondrial membrane 44
Synonyms: Tim44, Mimt44, D8Ertd118e, 0710005E20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21856
Homologene: 4631
Zfp707
Name: zinc finger protein 707
Synonyms: 1500031N24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69020
Homologene: 18364
Lmod1
Name: leiomodin 1 (smooth muscle)
Synonyms: 64kD D1, 1D, D1, SM-Lmod, 9530015K06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93689
HGNC: HGNC:6647
Homologene: 8118
Yipf7
Name: Yip1 domain family, member 7
Synonyms: Yip1b, 2310016N21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75581
Homologene: 69367
Hoxb4
Name: homeobox B4
Synonyms: Hox-2.6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15412
HGNC: HGNC:5115
Homologene: 32095
Bckdhb
Name: branched chain ketoacid dehydrogenase E1, beta polypeptide
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12040
HGNC: HGNC:987
Homologene: 39
Cib2
Name: calcium and integrin binding family member 2
Synonyms: calcium binding protein Kip2, 2810434I23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56506
Homologene: 4653
Npdc1
Name: neural proliferation, differentiation and control 1
Synonyms: NPDC-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18146
HGNC: HGNC:7899
Homologene: 32050
Cyp2a12
Name: cytochrome P450, family 2, subfamily a, polypeptide 12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13085
Homologene: 69128
Erich3
Name: glutamate rich 3
Synonyms: 5031409G23Rik, 4922501L14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 209601
Homologene: 27877
Rtkn2
Name: rhotekin 2
Synonyms: B130039D23Rik, RTKN2, Mbf, Plekhk1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 170799
Homologene: 17065
H1f10
Name: H1.10 linker histone
Synonyms: LOC243529, H1X, H1-10, H1fx
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243529
HGNC: HGNC:4722
Homologene: 4397
Neurl3
Name: neuralized E3 ubiquitin protein ligase 3
Synonyms: 2010300P06Rik, Lincr
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214854
Homologene: 35002
Or52m2
Name: olfactory receptor family 52 subfamily M member 2
Synonyms: GA_x6K02T2PBJ9-5333671-5332712, MOR25-2, Olfr553
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233578
Homologene: 17194
Or8b49
Name: olfactory receptor family 8 subfamily B member 49
Synonyms: GA_x6K02T2PVTD-32296575-32297513, MOR165-9P, MOR165-10, Olfr913
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258225
VEGA: 9
Homologene: 79398
Ppp2r3d
Name: protein phosphatase 2 (formerly 2A), regulatory subunit B'', delta
Synonyms: PR59, Ppp2r3, Ppp2r3a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19054
Hmga2
Name: high mobility group AT-hook 2
Synonyms: Hmgic, HMGI-C, 9430083A20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15364
HGNC: HGNC:5009
Homologene: 2602
Or1p1b
Name: olfactory receptor family 1 subfamily P member 1B
Synonyms: GA_x6K02T2P1NL-4385196-4386167, MOR133-5P, Olfr404-ps1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 257920
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 36,268,704 bp
  • A to T, chromosome 1 at 53,456,704 bp
  • A to G, chromosome 1 at 135,325,167 bp
  • A to T, chromosome 1 at 180,960,470 bp
  • T to C, chromosome 1 at 192,505,289 bp
  • T to A, chromosome 2 at 13,445,029 bp
  • T to C, chromosome 2 at 25,409,109 bp
  • A to G, chromosome 2 at 155,981,459 bp
  • C to A, chromosome 2 at 170,487,979 bp
  • T to A, chromosome 3 at 38,983,939 bp
  • G to C, chromosome 3 at 84,958,627 bp
  • A to T, chromosome 3 at 107,311,498 bp
  • C to A, chromosome 3 at 154,727,437 bp
  • A to G, chromosome 4 at 56,787,939 bp
  • A to T, chromosome 4 at 136,227,572 bp
  • T to A, chromosome 5 at 14,677,907 bp
  • A to G, chromosome 5 at 69,517,070 bp
  • A to T, chromosome 5 at 73,065,217 bp
  • C to A, chromosome 5 at 75,652,649 bp
  • A to T, chromosome 5 at 107,149,914 bp
  • CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC to CATC, chromosome 6 at 4,756,431 bp
  • A to T, chromosome 6 at 38,919,153 bp
  • G to A, chromosome 6 at 87,981,302 bp
  • T to C, chromosome 6 at 140,525,858 bp
  • T to C, chromosome 7 at 4,122,529 bp
  • A to T, chromosome 7 at 27,034,156 bp
  • C to T, chromosome 7 at 27,535,897 bp
  • G to C, chromosome 7 at 30,989,290 bp
  • A to G, chromosome 7 at 41,649,560 bp
  • A to T, chromosome 7 at 43,694,456 bp
  • GGCG to GGCGACGGCCGCG, chromosome 7 at 97,579,906 bp
  • G to A, chromosome 7 at 102,614,486 bp
  • A to G, chromosome 7 at 110,281,303 bp
  • A to G, chromosome 8 at 4,267,282 bp
  • A to T, chromosome 8 at 48,256,837 bp
  • T to C, chromosome 8 at 70,181,199 bp
  • T to A, chromosome 8 at 109,530,307 bp
  • T to A, chromosome 8 at 111,459,040 bp
  • T to C, chromosome 8 at 123,356,727 bp
  • C to G, chromosome 8 at 124,324,011 bp
  • T to C, chromosome 9 at 38,594,905 bp
  • G to T, chromosome 9 at 54,549,891 bp
  • T to C, chromosome 9 at 83,953,761 bp
  • T to C, chromosome 9 at 88,394,382 bp
  • A to G, chromosome 9 at 124,439,078 bp
  • A to T, chromosome 10 at 61,667,603 bp
  • G to A, chromosome 10 at 68,026,632 bp
  • T to C, chromosome 10 at 110,955,111 bp
  • T to A, chromosome 10 at 115,174,106 bp
  • A to C, chromosome 10 at 120,476,024 bp
  • T to C, chromosome 11 at 4,136,609 bp
  • C to A, chromosome 11 at 30,114,787 bp
  • C to T, chromosome 11 at 59,067,943 bp
  • T to C, chromosome 11 at 67,356,158 bp
  • T to A, chromosome 11 at 69,825,924 bp
  • T to C, chromosome 11 at 74,239,696 bp
  • C to T, chromosome 11 at 78,022,511 bp
  • C to T, chromosome 11 at 96,318,654 bp
  • T to C, chromosome 11 at 116,086,910 bp
  • C to G, chromosome 12 at 71,317,939 bp
  • A to T, chromosome 13 at 48,490,996 bp
  • A to G, chromosome 13 at 81,557,081 bp
  • T to C, chromosome 13 at 95,364,723 bp
  • T to C, chromosome 14 at 16,443,824 bp
  • A to T, chromosome 14 at 31,084,790 bp
  • A to T, chromosome 14 at 34,094,765 bp
  • A to T, chromosome 14 at 70,565,374 bp
  • T to C, chromosome 15 at 37,989,598 bp
  • T to G, chromosome 15 at 64,754,886 bp
  • C to T, chromosome 15 at 75,969,723 bp
  • T to C, chromosome 15 at 76,119,746 bp
  • T to G, chromosome 16 at 5,064,547 bp
  • T to A, chromosome 16 at 20,734,736 bp
  • A to T, chromosome 16 at 93,755,485 bp
  • T to C, chromosome 17 at 32,360,421 bp
  • A to T, chromosome 17 at 34,958,185 bp
  • C to A, chromosome 17 at 57,105,513 bp
  • T to A, chromosome 18 at 37,876,383 bp
  • A to G, chromosome 18 at 38,847,108 bp
  • A to T, chromosome 18 at 67,648,857 bp
  • A to T, chromosome 19 at 7,639,496 bp
  • T to A, chromosome 19 at 10,532,884 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6823 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044935-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.