Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6869Btlr/Mmmh
Stock Number:
044966-MU
Citation ID:
RRID:MMRRC_044966-MU
Other Names:
R6869 (G1)
Major Collection:

Strain Information

Cpe
Name: carboxypeptidase E
Synonyms: carboxypeptidase H, CPH, Cph1, Cph-1, NF-alpha1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12876
HGNC: HGNC:2303
Homologene: 48052
Pik3cb
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonyms: 1110001J02Rik, p110beta
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74769
HGNC: HGNC:8976
Homologene: 21250
Ptprk
Name: protein tyrosine phosphatase receptor type K
Synonyms: PTPk, RPTPkappa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19272
VEGA: 10
HGNC: HGNC:9674
Homologene: 55693
Ranbp17
Name: RAN binding protein 17
Synonyms: 4932704E15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66011
Homologene: 36409
Topors
Name: topoisomerase I binding, arginine/serine-rich
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 106021
Homologene: 4237
Hells
Name: helicase, lymphoid specific
Synonyms: Lysh, proliferation-associated SNF2-like, PASG, LSH, YFK8, E130115I21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15201
HGNC: HGNC:4861
Homologene: 50037
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 162,709,061 bp
  • G to T, chromosome 1 at 171,409,055 bp
  • G to A, chromosome 2 at 69,702,760 bp
  • T to A, chromosome 2 at 87,071,673 bp
  • T to C, chromosome 2 at 129,474,561 bp
  • T to C, chromosome 2 at 154,233,223 bp
  • T to C, chromosome 2 at 160,965,730 bp
  • C to T, chromosome 2 at 164,599,092 bp
  • G to A, chromosome 2 at 180,191,662 bp
  • T to C, chromosome 3 at 107,613,445 bp
  • A to C, chromosome 4 at 40,261,201 bp
  • T to A, chromosome 4 at 84,293,496 bp
  • A to G, chromosome 4 at 139,467,227 bp
  • A to T, chromosome 4 at 144,780,472 bp
  • G to T, chromosome 5 at 38,214,350 bp
  • G to A, chromosome 5 at 123,504,276 bp
  • A to C, chromosome 6 at 14,754,826 bp
  • T to C, chromosome 6 at 24,604,127 bp
  • A to G, chromosome 6 at 40,612,421 bp
  • T to C, chromosome 6 at 89,595,496 bp
  • T to C, chromosome 6 at 131,486,438 bp
  • G to T, chromosome 7 at 4,994,461 bp
  • A to G, chromosome 7 at 12,152,749 bp
  • T to A, chromosome 7 at 55,907,365 bp
  • C to T, chromosome 7 at 80,362,945 bp
  • GGCG to GGCGACGGCTGCG, chromosome 7 at 97,579,906 bp
  • G to A, chromosome 7 at 103,085,868 bp
  • T to C, chromosome 8 at 40,281,148 bp
  • T to C, chromosome 8 at 41,082,654 bp
  • A to G, chromosome 8 at 64,619,427 bp
  • A to T, chromosome 8 at 70,107,907 bp
  • A to G, chromosome 8 at 94,521,955 bp
  • A to G, chromosome 8 at 128,720,035 bp
  • A to T, chromosome 9 at 57,702,784 bp
  • A to T, chromosome 9 at 99,060,259 bp
  • A to G, chromosome 9 at 113,655,106 bp
  • A to T, chromosome 10 at 18,784,515 bp
  • T to C, chromosome 10 at 28,473,059 bp
  • T to C, chromosome 10 at 69,270,226 bp
  • T to G, chromosome 10 at 79,542,669 bp
  • T to C, chromosome 11 at 33,513,074 bp
  • T to A, chromosome 11 at 69,429,471 bp
  • G to A, chromosome 11 at 101,119,818 bp
  • A to T, chromosome 12 at 11,241,441 bp
  • T to C, chromosome 12 at 101,480,737 bp
  • A to T, chromosome 12 at 103,113,072 bp
  • A to T, chromosome 13 at 96,444,291 bp
  • G to A, chromosome 13 at 114,875,537 bp
  • C to T, chromosome 14 at 54,366,738 bp
  • T to C, chromosome 14 at 59,217,602 bp
  • T to C, chromosome 15 at 39,754,458 bp
  • T to A, chromosome 15 at 58,431,268 bp
  • T to C, chromosome 15 at 89,376,691 bp
  • C to A, chromosome 15 at 97,796,176 bp
  • A to G, chromosome 15 at 99,426,453 bp
  • A to G, chromosome 16 at 32,144,431 bp
  • A to T, chromosome 16 at 37,204,448 bp
  • G to A, chromosome 16 at 46,395,143 bp
  • A to G, chromosome 16 at 96,206,660 bp
  • T to C, chromosome 17 at 34,267,563 bp
  • A to T, chromosome 17 at 35,041,834 bp
  • A to G, chromosome 19 at 38,940,635 bp
  • T to A, chromosome 19 at 40,809,454 bp
  • T to A, chromosome 19 at 45,234,951 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6869 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044966-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.