Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6882Btlr/Mmmh
Stock Number:
044977-MU
Citation ID:
RRID:MMRRC_044977-MU
Other Names:
R6882 (G1)
Major Collection:

Strain Information

Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Foxj2
Name: forkhead box J2
Synonyms: Fhx
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 60611
Homologene: 10187
Ipo11
Name: importin 11
Synonyms: E330021B14Rik, 1700081H05Rik, 2510001A17Rik, Ranbp11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76582
Homologene: 7089
Prpf38a
Name: PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
Synonyms: 2410002M20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230596
Homologene: 13146
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Zfp341
Name: zinc finger protein 341
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228807
Homologene: 13127
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Zfp407
Name: zinc finger protein 407
Synonyms: LOC240469, LOC381139, 6430585N13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240476
Homologene: 86402
Cnot1
Name: CCR4-NOT transcription complex, subunit 1
Synonyms: 6030411K04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234594
HGNC: HGNC:7877
Homologene: 9453
Slc12a3
Name: solute carrier family 12, member 3
Synonyms: NCC, TSC
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20497
Homologene: 287
Actr10
Name: ARP10 actin-related protein 10
Synonyms: Arp11
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56444
VEGA: 12
Homologene: 10220
Ints13
Name: integrator complex subunit 13
Synonyms: 4933424B01Rik, Spata30, Asun
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71177
Homologene: 10043
Lmbr1l
Name: limb region 1 like
Synonyms: 1110013E13Rik, D15Ertd735e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74775
Homologene: 10011
Kcnn2
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Synonyms: small conductance calcium-activated potassium channel 2, SK2, fri, bc
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 140492
HGNC: HGNC:6291
Homologene: 135651
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Nid2
Name: nidogen 2
Synonyms: entactin-2, entactin 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18074
VEGA: 14
Homologene: 40575
Zfp398
Name: zinc finger protein 398
Synonyms: 5730513I23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 272347
Homologene: 12358
Sh3bp5l
Name: SH3 binding domain protein 5 like
Synonyms: 2310074E09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 79566
Homologene: 32584
Fnip1
Name: folliculin interacting protein 1
Synonyms: A730024A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216742
Homologene: 28173
Adgrf5
Name: adhesion G protein-coupled receptor F5
Synonyms: 8430401C09Rik, Gpr116
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224792
VEGA: 17
Homologene: 9065
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Tmx4
Name: thioredoxin-related transmembrane protein 4
Synonyms: 4930500L08Rik, 2810417D04Rik, D2Bwg1356e, Txndc13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 52837
Homologene: 10901
Vmn2r1
Name: vomeronasal 2, receptor 1
Synonyms: EG56544, V2r83
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56544
Homologene: 84832
Prg4
Name: proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
Synonyms: MSF, DOL54, lubricin, SZP
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 96875
HGNC: HGNC:9364
Homologene: 137352
Cdkl4
Name: cyclin dependent kinase like 4
Synonyms: LOC381113
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381113
VEGA: 17
Homologene: 28725
Etv3
Name: ets variant 3
Synonyms: ETS-domain transcriptional repressor, METS, Pe1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 27049
HGNC: HGNC:3492
Homologene: 21085
Golgb1
Name: golgin B1
Synonyms: Giantin, C130074L01Rik, F730017E11Rik, 6330407A06Rik, Gm6840
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224139
HGNC: HGNC:4429
Homologene: 68401
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Col6a5, Gm7455
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 665033
Homologene: 122792
Cacnb2
Name: calcium channel, voltage-dependent, beta 2 subunit
Synonyms: Cchb2, Cavbeta2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12296
HGNC: HGNC:1402
Homologene: 75191
Csmd2
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329942
Homologene: 89034
Pbld1
Name: phenazine biosynthesis-like protein domain containing 1
Synonyms: 0610038K03Rik, Pbld
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68371
VEGA: 10
Homologene: 41470
Zbbx
Name: zinc finger, B-box domain containing
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213234
Homologene: 11661
Tnni3k
Name: TNNI3 interacting kinase
Synonyms: Cark, D830019J24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 435766
Homologene: 41084
Zfp52
Name: zinc finger protein 52
Synonyms: zfec29, Zfp-52, KRAB11, Zfp76
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22710
VEGA: 17
Homologene: 77326
Tmprss11b
Name: transmembrane protease, serine 11B
Synonyms: 9930019B18Rik, Tmprss11bnl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319875
Homologene: 64599
Cbll1
Name: Casitas B-lineage lymphoma-like 1
Synonyms: c-Cbl-like, Hakai
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104836
Homologene: 11734
Klra9
Name: killer cell lectin-like receptor subfamily A, member 9
Synonyms: Ly49I, LY49I1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16640
Homologene: 110821
Lrrc18
Name: leucine rich repeat containing 18
Synonyms: 4930442L21Rik, mtLR1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67580
Homologene: 81914
Ccdc7a
Name: coiled-coil domain containing 7A
Synonyms: 4930540C21Rik, 4930517G15Rik, Ccdc7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74703
Homologene: 134760
Cage1
Name: cancer antigen 1
Synonyms: CAGE1, 4933427I01Rik, Ctag3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71213
Homologene: 18484
Rhbg
Name: Rhesus blood group-associated B glycoprotein
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 58176
Homologene: 9469
Kcns3
Name: potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Synonyms: D12Ertd137e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238076
VEGA: 12
HGNC: HGNC:6302
Homologene: 20518
Mr1
Name: major histocompatibility complex, class I-related
Synonyms: MR1, H2ls
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15064
HGNC: HGNC:4975
Homologene: 123981
Or5an10
Name: olfactory receptor family 5 subfamily AN member 10
Synonyms: GA_x6K02T2RE5P-2634596-2633658, MOR214-2, Olfr1436
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258682
Homologene: 83129
Or2y1c
Name: olfactory receptor family 2 subfamily Y member 1C
Synonyms: GA_x6K02T2QP88-5964781-5963852, MOR256-50, Olfr1386
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 257888
Homologene: 86692
Fosl2
Name: fos-like antigen 2
Synonyms: Fra-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14284
HGNC: HGNC:3798
Homologene: 3845
Rnf183
Name: ring finger protein 183
Synonyms: 5830442J12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76072
Homologene: 44917
Sycp3
Name: synaptonemal complex protein 3
Synonyms: Scp3, Cor1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20962
Homologene: 7964
C2cd6
Name: C2 calcium dependent domain containing 6
Synonyms: 1700052H20Rik, 4930408G06Rik, Als2cr11, Als2cr11b, Gm33589, C2cd6b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73463
Homologene: 134310
Or6d12
Name: olfactory receptor family 6 subfamily D member 12
Synonyms: GA_x54KRFPKN04-58149882-58150865, MOR119-4, 4931403F16Rik, Olfr212
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258019
Homologene: 74186
Epn3
Name: epsin 3
Synonyms: 2310022G12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71889
Homologene: 56791
Or5h24
Name: olfactory receptor family 5 subfamily H member 24, pseudogene 1
Synonyms: GA_x54KRFPKG5P-55327126-55326203, MOR183-11_p, Olfr192
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 404309
Homologene: 131129
Tnfsf10
Name: tumor necrosis factor (ligand) superfamily, member 10
Synonyms: APO-2L, Trail, A330042I21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22035
Homologene: 2824
Igkv4-55
Name: immunoglobulin kappa variable 4-55
Synonyms: LOC385253, Gm1524
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 385253
Ccdc166
Name: coiled-coil domain containing 166
Synonyms: 2410075B13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223648
Homologene: 109421
Iglc1
Name: immunoglobulin lambda constant 1
Synonyms: Clambda1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110785
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 59,066,159 bp
  • G to A, chromosome 1 at 150,453,495 bp
  • G to A, chromosome 1 at 151,193,129 bp
  • A to G, chromosome 1 at 155,132,453 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 162,709,061 bp
  • T to A, chromosome 2 at 14,824,299 bp
  • T to A, chromosome 2 at 76,814,195 bp
  • T to C, chromosome 2 at 134,644,002 bp
  • T to C, chromosome 2 at 154,638,023 bp
  • G to A, chromosome 2 at 180,191,662 bp
  • T to C, chromosome 3 at 27,326,033 bp
  • A to T, chromosome 3 at 64,090,108 bp
  • A to G, chromosome 3 at 75,071,712 bp
  • T to C, chromosome 3 at 87,529,270 bp
  • T to A, chromosome 3 at 88,245,220 bp
  • T to G, chromosome 3 at 126,945,757 bp
  • T to A, chromosome 3 at 154,957,720 bp
  • A to G, chromosome 4 at 62,428,024 bp
  • A to G, chromosome 4 at 91,308,715 bp
  • C to A, chromosome 4 at 108,570,168 bp
  • A to G, chromosome 4 at 128,449,269 bp
  • T to C, chromosome 5 at 32,152,864 bp
  • T to A, chromosome 5 at 86,671,671 bp
  • A to G, chromosome 6 at 47,866,082 bp
  • A to G, chromosome 6 at 69,607,305 bp
  • T to C, chromosome 6 at 116,516,434 bp
  • T to A, chromosome 6 at 122,828,505 bp
  • A to T, chromosome 6 at 130,179,022 bp
  • G to T, chromosome 6 at 146,563,441 bp
  • A to G, chromosome 7 at 119,971,184 bp
  • T to A, chromosome 8 at 94,365,918 bp
  • T to C, chromosome 8 at 95,720,426 bp
  • T to C, chromosome 8 at 128,797,328 bp
  • G to A, chromosome 9 at 105,940,270 bp
  • T to C, chromosome 10 at 63,061,462 bp
  • T to C, chromosome 10 at 76,427,828 bp
  • C to T, chromosome 10 at 88,472,929 bp
  • A to T, chromosome 11 at 49,470,463 bp
  • A to G, chromosome 11 at 54,509,898 bp
  • G to T, chromosome 11 at 58,331,699 bp
  • G to A, chromosome 11 at 60,524,006 bp
  • C to T, chromosome 11 at 94,491,360 bp
  • C to T, chromosome 12 at 11,092,048 bp
  • A to G, chromosome 12 at 31,487,485 bp
  • A to G, chromosome 12 at 70,956,351 bp
  • T to A, chromosome 13 at 38,022,558 bp
  • T to C, chromosome 13 at 106,900,682 bp
  • A to G, chromosome 14 at 19,789,707 bp
  • A to C, chromosome 14 at 33,008,689 bp
  • T to C, chromosome 15 at 75,981,617 bp
  • A to G, chromosome 15 at 98,907,586 bp
  • G to A, chromosome 16 at 15,783,263 bp
  • T to A, chromosome 16 at 15,808,156 bp
  • G to A, chromosome 16 at 19,061,849 bp
  • C to A, chromosome 16 at 36,913,990 bp
  • A to T, chromosome 16 at 59,098,627 bp
  • T to C, chromosome 17 at 21,555,047 bp
  • G to T, chromosome 17 at 25,960,179 bp
  • T to A, chromosome 17 at 43,450,380 bp
  • T to A, chromosome 17 at 80,543,746 bp
  • A to T, chromosome 18 at 45,559,438 bp
  • A to G, chromosome 18 at 49,843,784 bp
  • G to T, chromosome 18 at 84,343,069 bp
  • C to A, chromosome 19 at 12,298,570 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6882 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044977-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.