Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6884Btlr/Mmmh
Stock Number:
044979-MU
Citation ID:
RRID:MMRRC_044979-MU
Other Names:
R6884 (G1)
Major Collection:

Strain Information

Morf4l1
Name: mortality factor 4 like 1
Synonyms: TEG-189, MRG15, MORFRG15, Tex189
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21761
Homologene: 86043
Dapk3
Name: death-associated protein kinase 3
Synonyms: ZIP kinase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13144
VEGA: 10
HGNC: HGNC:2676
Homologene: 20353
Brpf3
Name: bromodomain and PHD finger containing, 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268936
Homologene: 16092
Mtcl1
Name: microtubule crosslinking factor 1
Synonyms: t8219b25, 1110012J17Rik, Soga2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68617
Homologene: 41017
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Slc25a25
Name: solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25
Synonyms: 1110030N17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227731
Homologene: 62165
Nr2c2
Name: nuclear receptor subfamily 2, group C, member 2
Synonyms: TAK1, Tr4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22026
HGNC: HGNC:7972
Homologene: 2475
Eif3c
Name: eukaryotic translation initiation factor 3, subunit C
Synonyms: NIPIL(A3), 110kDa, 3230401O13Rik, Eif3s8, Xsl, Xs
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56347
Homologene: 2781
Tshr
Name: thyroid stimulating hormone receptor
Synonyms: hyt, pet, hypothroid
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22095
Homologene: 315
Dcaf13
Name: DDB1 and CUL4 associated factor 13
Synonyms: LOC223499, Wdsof1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223499
Homologene: 6430
Ing1
Name: inhibitor of growth family, member 1
Synonyms: p33Ing1, mING1h, 2610028J21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26356
HGNC: HGNC:6062
Homologene: 40119
Uvssa
Name: UV stimulated scaffold protein A
Synonyms: D330017J19Rik, 4933407H18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71101
Homologene: 13807
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Aamp
Name: angio-associated migratory protein
Synonyms: Aamp-rs
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227290
HGNC: HGNC:18
Homologene: 846
Htr7
Name: 5-hydroxytryptamine (serotonin) receptor 7
Synonyms: 5-HT7
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15566
HGNC: HGNC:5302
Homologene: 20244
Ret
Name: ret proto-oncogene
Synonyms: RET51, RET9, c-Ret
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19713
HGNC: HGNC:9967
Homologene: 7517
Pigo
Name: phosphatidylinositol glycan anchor biosynthesis, class O
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56703
Homologene: 31761
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Vmn1r28
Name: vomeronasal 1 receptor 28
Synonyms: V1rc25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171198
Homologene: 138094
Spocd1
Name: SPOC domain containing 1
Synonyms: OTTMUSG00000009522
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 622480
Homologene: 83439
Slc35e1
Name: solute carrier family 35, member E1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270066
Homologene: 49075
Rubcnl
Name: RUN and cysteine rich domain containing beclin 1 interacting protein like
Synonyms: LOC380917, 5031414D18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 271221
VEGA: 14
Homologene: 57021
Gdpd4
Name: glycerophosphodiester phosphodiesterase domain containing 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233537
Homologene: 18606
Ahnak2
Name: AHNAK nucleoprotein 2
Synonyms: LOC382643
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100041194
Homologene: 131081
Mug5
Name: murinoglobulin 5
Synonyms: Gm7298
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 640530
HGNC: HGNC:9750
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Cacna1i
Name: calcium channel, voltage-dependent, alpha 1I subunit
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239556
HGNC: HGNC:1396
Homologene: 69331
Shoc1
Name: shortage in chiasmata 1
Synonyms: LOC242489, Gm426, AI481877, Mzip2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100155
Homologene: 79783
Vmn2r73
Name: vomeronasal 2, receptor 73
Synonyms: EG620928
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620928
Homologene: 115466
Abca5
Name: ATP-binding cassette, sub-family A member 5
Synonyms: ABC13, B930033A02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217265
HGNC: HGNC:35
Homologene: 10263
Ccdc40
Name: coiled-coil domain containing 40
Synonyms: B930008I02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207607
Homologene: 27890
Krtap16-1
Name: keratin associated protein 16-1
Synonyms: AI450886
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 100504183
Homologene: 99988
Serpinb9e
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9e
Synonyms: ovalbumin, Spi14, NK26
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20710
HGNC: HGNC:8955
Homologene: 69093
Dip2a
Name: disco interacting protein 2 homolog A
Synonyms: Kiaa0184-hp, 4931420H10Rik, Dip2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64451
Homologene: 41012
Krtap26-1
Name: keratin associated protein 26-1
Synonyms: 2310002B14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69533
VEGA: 16
Homologene: 88911
Myb
Name: myeloblastosis oncogene
Synonyms: c-myb
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17863
HGNC: HGNC:7545
Homologene: 31311
Pde6b
Name: phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonyms: rd, r, Pdeb, rd10, rd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18587
HGNC: HGNC:8786
Homologene: 237
Mpp2
Name: membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
Synonyms: Dlg2, Dlgh2, Pals4, D11Bwg0652e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50997
HGNC: HGNC:7220
Homologene: 3920
Tmem222
Name: transmembrane protein 222
Synonyms: 5730406H10Rik, D4Ertd196e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 52174
Homologene: 11999
Erich2
Name: glutamate rich 2
Synonyms: 4933404M02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66748
Homologene: 75226
Or2z9
Name: olfactory receptor family 2 subfamily Z member 9
Synonyms: GA_x6K02T2NUPS-231686-232630, MOR282-1, MOR282-2, Olfr373
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 258532
Homologene: 17287
Top1mt
Name: DNA topoisomerase 1, mitochondrial
Synonyms: 2900052H09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72960
Homologene: 43082
Or6c3
Name: olfactory receptor family 6 subfamily C member 3
Synonyms: GA_x6K02T2PULF-11151514-11152449, MOR111-4, Olfr788
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258544
Homologene: 74200
Gcnt7
Name: glucosaminyl (N-acetyl) transferase family member 7
Synonyms: A330041C17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 654821
Homologene: 107308
Gm10269
Name: predicted gene 10269
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100040823
VEGA: 18
Serpina1b
Name: serine (or cysteine) preptidase inhibitor, clade A, member 1B
Synonyms: PI2, D12Ucla2, Spi1-2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20701
HGNC: HGNC:8941
Homologene: 20103
Traj42
Name: T cell receptor alpha joining 42
Synonyms: Gm16922
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100124346
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 74,284,248 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 162,709,061 bp
  • A to C, chromosome 2 at 32,420,662 bp
  • G to A, chromosome 2 at 70,509,161 bp
  • T to C, chromosome 2 at 172,454,205 bp
  • G to A, chromosome 2 at 180,191,662 bp
  • A to T, chromosome 3 at 93,395,789 bp
  • A to G, chromosome 4 at 43,022,627 bp
  • A to G, chromosome 4 at 59,059,652 bp
  • T to C, chromosome 4 at 129,955,404 bp
  • A to T, chromosome 4 at 133,268,203 bp
  • A to G, chromosome 5 at 33,409,117 bp
  • A to G, chromosome 5 at 108,388,708 bp
  • G to A, chromosome 6 at 58,265,648 bp
  • A to G, chromosome 6 at 92,158,393 bp
  • T to C, chromosome 6 at 118,155,401 bp
  • A to T, chromosome 6 at 121,760,521 bp
  • T to A, chromosome 7 at 85,858,005 bp
  • G to T, chromosome 7 at 97,972,175 bp
  • T to C, chromosome 7 at 126,556,879 bp
  • A to G, chromosome 8 at 11,561,916 bp
  • T to C, chromosome 8 at 72,100,501 bp
  • T to C, chromosome 8 at 72,484,882 bp
  • C to T, chromosome 9 at 79,639,809 bp
  • A to T, chromosome 9 at 90,094,479 bp
  • T to A, chromosome 10 at 21,152,532 bp
  • C to A, chromosome 10 at 76,272,532 bp
  • T to A, chromosome 10 at 81,191,754 bp
  • T to A, chromosome 10 at 127,559,117 bp
  • T to A, chromosome 10 at 129,473,154 bp
  • A to G, chromosome 11 at 59,078,302 bp
  • T to C, chromosome 11 at 77,819,049 bp
  • C to T, chromosome 11 at 99,986,458 bp
  • T to C, chromosome 11 at 102,062,078 bp
  • C to T, chromosome 11 at 110,329,217 bp
  • A to T, chromosome 11 at 119,242,739 bp
  • T to C, chromosome 12 at 91,538,102 bp
  • T to A, chromosome 12 at 103,732,453 bp
  • A to T, chromosome 12 at 112,775,429 bp
  • A to T, chromosome 13 at 33,251,626 bp
  • T to C, chromosome 14 at 54,175,833 bp
  • A to G, chromosome 14 at 75,035,470 bp
  • T to C, chromosome 15 at 39,123,240 bp
  • C to T, chromosome 15 at 75,664,044 bp
  • C to T, chromosome 15 at 80,374,809 bp
  • A to T, chromosome 16 at 88,647,579 bp
  • A to G, chromosome 17 at 28,831,350 bp
  • C to T, chromosome 17 at 66,438,202 bp
  • T to A, chromosome 18 at 20,682,875 bp
  • A to G, chromosome 19 at 35,964,379 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6884 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044979-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.