Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6908Btlr/Mmmh
Stock Number:
045000-MU
Citation ID:
RRID:MMRRC_045000-MU
Other Names:
R6908 (G1)
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Dlc1
Name: deleted in liver cancer 1
Synonyms: p122-RhoGAP, STARD12, Arhgap7, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Cxxc5
Name: CXXC finger 5
Synonyms: 4930415K17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67393
VEGA: 18
Homologene: 9517
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: 5830453M24Rik, Pdzgef1, RA-GEF-1, CNRasGEF, nRapGEP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76089
Homologene: 35477
Tyw5
Name: tRNA-yW synthesizing protein 5
Synonyms: 1110034B05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68736
Homologene: 72085
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 9,930,778 bp
  • T to C, chromosome 1 at 57,401,523 bp
  • T to C, chromosome 2 at 23,155,976 bp
  • T to C, chromosome 2 at 33,143,100 bp
  • C to T, chromosome 2 at 60,650,021 bp
  • A to T, chromosome 2 at 69,472,365 bp
  • C to A, chromosome 2 at 76,889,858 bp
  • G to A, chromosome 2 at 121,453,605 bp
  • A to T, chromosome 3 at 79,104,063 bp
  • GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC to GCCGCCGCAGCAGCC, chromosome 4 at 127,021,626 bp
  • T to C, chromosome 5 at 27,791,224 bp
  • A to G, chromosome 5 at 73,022,211 bp
  • T to G, chromosome 5 at 105,221,032 bp
  • T to C, chromosome 5 at 149,696,476 bp
  • G to T, chromosome 6 at 39,144,439 bp
  • A to T, chromosome 6 at 146,555,033 bp
  • G to C, chromosome 7 at 24,638,433 bp
  • T to C, chromosome 7 at 103,827,534 bp
  • T to C, chromosome 7 at 106,944,632 bp
  • A to G, chromosome 7 at 126,448,535 bp
  • T to C, chromosome 8 at 13,018,919 bp
  • A to G, chromosome 8 at 36,937,687 bp
  • A to T, chromosome 8 at 67,964,177 bp
  • A to G, chromosome 8 at 90,956,416 bp
  • T to G, chromosome 9 at 22,567,723 bp
  • A to G, chromosome 9 at 35,013,401 bp
  • T to C, chromosome 9 at 53,706,069 bp
  • T to C, chromosome 9 at 59,603,823 bp
  • A to T, chromosome 9 at 119,792,426 bp
  • A to T, chromosome 10 at 27,031,196 bp
  • C to A, chromosome 10 at 63,397,325 bp
  • T to C, chromosome 11 at 55,149,886 bp
  • A to T, chromosome 11 at 60,506,006 bp
  • T to C, chromosome 11 at 71,217,296 bp
  • T to C, chromosome 11 at 86,077,884 bp
  • T to G, chromosome 11 at 103,058,254 bp
  • A to T, chromosome 12 at 116,888,888 bp
  • T to C, chromosome 13 at 22,806,230 bp
  • G to A, chromosome 13 at 24,706,232 bp
  • T to G, chromosome 14 at 55,863,878 bp
  • C to T, chromosome 14 at 64,096,152 bp
  • A to G, chromosome 15 at 25,804,383 bp
  • G to A, chromosome 15 at 76,185,881 bp
  • A to G, chromosome 15 at 85,107,010 bp
  • T to G, chromosome 16 at 34,880,273 bp
  • T to C, chromosome 16 at 56,657,305 bp
  • T to G, chromosome 16 at 63,598,249 bp
  • C to A, chromosome 17 at 20,182,439 bp
  • T to C, chromosome 18 at 35,859,215 bp
  • G to T, chromosome 18 at 37,296,524 bp
  • G to A, chromosome 18 at 74,220,559 bp
  • A to G, chromosome 19 at 11,638,295 bp
  • G to A, chromosome 19 at 25,188,382 bp
  • A to G, chromosome 19 at 40,352,332 bp
  • A to G, chromosome 19 at 44,152,446 bp
  • A to T, chromosome 19 at 56,791,939 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6908 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045000-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.