Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6908Btlr/Mmmh
Stock Number:
045000-MU
Citation ID:
RRID:MMRRC_045000-MU
Other Names:
R6908 (G1)
Major Collection:

Strain Information

Myo10
Name: myosin X
Synonyms: myosin-X, D15Ertd600e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17909
HGNC: HGNC:7593
Homologene: 36328
Dlc1
Name: deleted in liver cancer 1
Synonyms: p122-RhoGAP, STARD12, Arhgap7, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Cxxc5
Name: CXXC finger 5
Synonyms: 4930415K17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67393
VEGA: 18
Homologene: 9517
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: 5830453M24Rik, Pdzgef1, RA-GEF-1, CNRasGEF, nRapGEP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76089
Homologene: 35477
Tyw5
Name: tRNA-yW synthesizing protein 5
Synonyms: 1110034B05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68736
Homologene: 72085
Nmt1
Name: N-myristoyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18107
HGNC: HGNC:7857
Homologene: 69027
Sfpq
Name: splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)
Synonyms: D4Ertd314e, 9030402K04Rik, 2810416M14Rik, 5730453G22Rik, 1110004P21Rik, REP1, PSF
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71514
Homologene: 3714
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Ints13
Name: integrator complex subunit 13
Synonyms: Spata30, 4933424B01Rik, Asun
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71177
Homologene: 10043
Mastl
Name: microtubule associated serine/threonine kinase-like
Synonyms: THC2, 2700091H24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67121
Homologene: 12086
Bbs9
Name: Bardet-Biedl syndrome 9
Synonyms: EST 3159894, E130103I17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319845
Homologene: 44480
Mcf2l
Name: mcf.2 transforming sequence-like
Synonyms: Dbs, C130040G20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17207
Homologene: 11804
Celf6
Name: CUGBP, Elav-like family member 6
Synonyms: 6330569O16Rik, Brunol6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76183
Homologene: 129318
Ripor2
Name: RHO family interacting cell polarization regulator 2
Synonyms: 1700108N18Rik, E430013J17Rik, 6330500D04Rik, Fam65b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 193385
Homologene: 9284
Kirrel3
Name: kirre like nephrin family adhesion molecule 3
Synonyms: Neph2, 1500010O20Rik, 2900036G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67703
Homologene: 57050
Paxip1
Name: PAX interacting (with transcription-activation domain) protein 1
Synonyms: PTIP, D5Ertd149e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 55982
HGNC: HGNC:8624
Cxxc1
Name: CXXC finger protein 1
Synonyms: 5830420C16Rik, 2410002I16Rik, PHF18, Cgbp, Cfp1, CXXC finger 1 (PHD domain)
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74322
VEGA: 18
Homologene: 32221
Serinc4
Name: serine incorporator 4
Synonyms: A930015D22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 574418
Homologene: 67424
Brip1
Name: BRCA1 interacting protein C-terminal helicase 1
Synonyms: 8030460J03Rik, BACH1, 3110009N10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237911
Homologene: 32766
Dnajc12
Name: DnaJ heat shock protein family (Hsp40) member C12
Synonyms: J domain protein 1, mJDP1, Jdp1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 30045
Homologene: 8492
Dock8
Name: dedicator of cytokinesis 8
Synonyms: 1200017A24Rik, 5830472H07Rik, A130095G14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76088
VEGA: 19
Homologene: 52414
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Epha3
Name: Eph receptor A3
Synonyms: Tyro4, Mek4, Hek4, Hek, Cek4, End3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13837
VEGA: 16
HGNC: HGNC:3387
Homologene: 21083
Nlrp1b
Name: NLR family, pyrin domain containing 1B
Synonyms: Nalp1b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 637515
Homologene: 19080
Ralgps1
Name: Ral GEF with PH domain and SH3 binding motif 1
Synonyms: RALGPS1A, RALGEF2, 5830418G11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241308
Homologene: 65163
Nynrin
Name: NYN domain and retroviral integrase containing
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 277154
VEGA: 14
Homologene: 19483
Kdm7a
Name: lysine (K)-specific demethylase 7A
Synonyms: A630082K20Rik, ENSMUSG00000073143, Kdm7a, Jhdm1d
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 338523
Homologene: 25281
Atp2a1
Name: ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Synonyms: SERCA1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11937
HGNC: HGNC:811
Homologene: 7635
Psd3
Name: pleckstrin and Sec7 domain containing 3
Synonyms: 4931420C21Rik, EFA6D
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234353
Homologene: 87257
Ptprn2
Name: protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms: PTP-NP, IA-2 beta, phogrin, IA-2beta, 4930425H11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19276
HGNC: HGNC:9677
Homologene: 2134
Smc1b
Name: structural maintenance of chromosomes 1B
Synonyms: SMC1beta, Smc1l2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 140557
VEGA: 15
Homologene: 13786
Mylk
Name: myosin, light polypeptide kinase
Synonyms: telokin, Mlck, MLCK210, MLCK108, 9530072E15Rik, A930019C19Rik, nmMlck
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Fpr-rs6
Name: formyl peptide receptor, related sequence 6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 321020
Homologene: 104303
Pcdhb2
Name: protocadherin beta 2
Synonyms: PcdhbB
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93873
HGNC: HGNC:8687
Homologene: 69266
B3glct
Name: beta-3-glucosyltransferase
Synonyms: LOC381694, B3galtl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381694
Homologene: 14978
Lypd3
Name: Ly6/Plaur domain containing 3
Synonyms: C4.4A, 2310061G07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72434
Homologene: 8672
Rab39
Name: RAB39, member RAS oncogene family
Synonyms: C230094F14Rik, Rab39a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270160
Homologene: 56773
Scn11a
Name: sodium channel, voltage-gated, type XI, alpha
Synonyms: SNS2, NaN, NaT, NSS2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24046
VEGA: 9
Homologene: 8041
Mcmdc2
Name: minichromosome maintenance domain containing 2
Synonyms: 6030422M02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240697
Homologene: 18309
Ccdc186
Name: coiled-coil domain containing 186
Synonyms: Otg1, 1810028B20Rik, A630007B06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 213993
Homologene: 9963
Gbp10
Name: guanylate-binding protein 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 626578
Homologene: 128731
Itgb6
Name: integrin beta 6
Synonyms: 4831415H04Rik, 2210409C20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16420
HGNC: HGNC:6161
Homologene: 685
Abi3bp
Name: ABI family member 3 binding protein
Synonyms: 5033411B22Rik, D930038M13Rik, eratin, TARSH
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320712
VEGA: 16
Homologene: 134172
Vmn1r209
Name: vomeronasal 1 receptor 209
Synonyms: Gm11315
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 432736
Homologene: 110880
Prss51
Name: serine protease 51
Synonyms: 1700007N14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100504162
Homologene: 131540
Ms4a3
Name: membrane-spanning 4-domains, subfamily A, member 3
Synonyms: haematopoietic cell-specific transmembrane-4, HTm4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 170813
HGNC: HGNC:7317
Homologene: 4472
Slc36a3
Name: solute carrier family 36 (proton/amino acid symporter), member 3
Synonyms: tramdorin2, PAT3, TRAMD2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 215332
Homologene: 76175
Pkd2l1
Name: polycystic kidney disease 2-like 1
Synonyms: polycystin-L, Pkdl, PCL, TRPP3, PKD2L
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329064
HGNC: HGNC:9011
Homologene: 22946
Or2d4
Name: olfactory receptor family 2 subfamily D member 4
Synonyms: GA_x6K02T2PBJ9-9325348-9324416, MOR260-3, Olfr710
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258594
Homologene: 27218
Hbb-bs
Name: hemoglobin, beta adult s chain
Synonyms: beta s
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100503605
Homologene: 68066
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 9,930,778 bp
  • T to C, chromosome 1 at 57,401,523 bp
  • T to C, chromosome 2 at 23,155,976 bp
  • T to C, chromosome 2 at 33,143,100 bp
  • C to T, chromosome 2 at 60,650,021 bp
  • A to T, chromosome 2 at 69,472,365 bp
  • C to A, chromosome 2 at 76,889,858 bp
  • G to A, chromosome 2 at 121,453,605 bp
  • A to T, chromosome 3 at 79,104,063 bp
  • GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC to GCCGCCGCAGCAGCC, chromosome 4 at 127,021,626 bp
  • T to C, chromosome 5 at 27,791,224 bp
  • A to G, chromosome 5 at 73,022,211 bp
  • T to G, chromosome 5 at 105,221,032 bp
  • T to C, chromosome 5 at 149,696,476 bp
  • G to T, chromosome 6 at 39,144,439 bp
  • A to T, chromosome 6 at 146,555,033 bp
  • G to C, chromosome 7 at 24,638,433 bp
  • T to C, chromosome 7 at 103,827,534 bp
  • T to C, chromosome 7 at 106,944,632 bp
  • A to G, chromosome 7 at 126,448,535 bp
  • T to C, chromosome 8 at 13,018,919 bp
  • A to G, chromosome 8 at 36,937,687 bp
  • A to T, chromosome 8 at 67,964,177 bp
  • A to G, chromosome 8 at 90,956,416 bp
  • T to G, chromosome 9 at 22,567,723 bp
  • A to G, chromosome 9 at 35,013,401 bp
  • T to C, chromosome 9 at 53,706,069 bp
  • T to C, chromosome 9 at 59,603,823 bp
  • A to T, chromosome 9 at 119,792,426 bp
  • A to T, chromosome 10 at 27,031,196 bp
  • C to A, chromosome 10 at 63,397,325 bp
  • T to C, chromosome 11 at 55,149,886 bp
  • A to T, chromosome 11 at 60,506,006 bp
  • T to C, chromosome 11 at 71,217,296 bp
  • T to C, chromosome 11 at 86,077,884 bp
  • T to G, chromosome 11 at 103,058,254 bp
  • A to T, chromosome 12 at 116,888,888 bp
  • T to C, chromosome 13 at 22,806,230 bp
  • G to A, chromosome 13 at 24,706,232 bp
  • T to G, chromosome 14 at 55,863,878 bp
  • C to T, chromosome 14 at 64,096,152 bp
  • A to G, chromosome 15 at 25,804,383 bp
  • G to A, chromosome 15 at 76,185,881 bp
  • A to G, chromosome 15 at 85,107,010 bp
  • T to G, chromosome 16 at 34,880,273 bp
  • T to C, chromosome 16 at 56,657,305 bp
  • T to G, chromosome 16 at 63,598,249 bp
  • C to A, chromosome 17 at 20,182,439 bp
  • T to C, chromosome 18 at 35,859,215 bp
  • G to T, chromosome 18 at 37,296,524 bp
  • G to A, chromosome 18 at 74,220,559 bp
  • A to G, chromosome 19 at 11,638,295 bp
  • G to A, chromosome 19 at 25,188,382 bp
  • A to G, chromosome 19 at 40,352,332 bp
  • A to G, chromosome 19 at 44,152,446 bp
  • A to T, chromosome 19 at 56,791,939 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6908 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045000-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.