Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6929Btlr/Mmmh
Stock Number:
045007-MU
Citation ID:
RRID:MMRRC_045007-MU
Other Names:
R6929 (G1)
Major Collection:

Strain Information

Rnd3
Name: Rho family GTPase 3
Synonyms: 2610017M01Rik, Arhe, Rhoe
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74194
HGNC: HGNC:671
Homologene: 21074
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Ankrd17
Name: ankyrin repeat domain 17
Synonyms: Gtar, 4933425K22Rik, A130069E23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 81702
Homologene: 82403
Sfpq
Name: splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)
Synonyms: D4Ertd314e, 9030402K04Rik, 2810416M14Rik, 5730453G22Rik, 1110004P21Rik, REP1, PSF
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71514
Homologene: 3714
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Prpf40a
Name: pre-mRNA processing factor 40A
Synonyms: FBP11, 2810012K09Rik, Fnbp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56194
Homologene: 6377
Mc4r
Name: melanocortin 4 receptor
Synonyms: Fatboy, Pkcp
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17202
VEGA: 18
HGNC: HGNC:6932
Homologene: 4320
C2cd3
Name: C2 calcium-dependent domain containing 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277939
Homologene: 19524
Ifnar2
Name: interferon (alpha and beta) receptor 2
Synonyms: Ifnar-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15976
HGNC: HGNC:5433
Homologene: 49242
Cep295
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319675
Homologene: 27936
Adamts13
Name: ADAM metallopeptidase with thrombospondin type 1 motif 13
Synonyms: LOC279028, vWF-CP mRNA for von Willebrand factor-cleaving
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 279028
HGNC: HGNC:1366
Homologene: 16372
Fyb1
Name: FYN binding protein 1
Synonyms: FYB-120/130, ADAP, B630013F22Rik, Fyb
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 23880
HGNC: HGNC:4036
Homologene: 22664
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Spats2l
Name: spermatogenesis associated, serine-rich 2-like
Synonyms: A230104H11Rik, 2810022L02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67198
Homologene: 56711
Pik3c2g
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18705
HGNC: HGNC:8973
Homologene: 3362
Adgrb3
Name: adhesion G protein-coupled receptor B3
Synonyms: A830096D10Rik, Bai3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210933
HGNC: HGNC:945
Homologene: 1289
Or8b42
Name: olfactory receptor family 8 subfamily B member 42
Synonyms: GA_x6K02T2PVTD-32123032-32123967, MOR162-8, Olfr901
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258028
VEGA: 9
Homologene: 79399
Tmem202
Name: transmembrane protein 202
Synonyms: 4930425N13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73893
VEGA: 9
Homologene: 52264
Ulk4
Name: unc-51-like kinase 4
Synonyms: 4932415A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209012
Homologene: 41205
Pear1
Name: platelet endothelial aggregation receptor 1
Synonyms: 3110045G13Rik, Jedi-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73182
Homologene: 12492
Cacna1b
Name: calcium channel, voltage-dependent, N type, alpha 1B subunit
Synonyms: Cchn1a, alpha(1B), Cav2.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12287
HGNC: HGNC:1389
Homologene: 20184
Kdr
Name: kinase insert domain protein receptor
Synonyms: VEGF receptor-2, VEGFR-2, vascular endothelial growth factor receptor- 2, VEGFR2, Flk-1, Flk1, orv
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16542
HGNC: HGNC:6307
Homologene: 55639
Fam120b
Name: family with sequence similarity 120, member B
Synonyms: CCPG, 4932442K08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67544
VEGA: 17
Homologene: 13033
C2
Name: complement C2
Synonyms: classical-complement pathway C3/C5 convertase
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12263
HGNC: HGNC:1248
Homologene: 45
Lrrc9
Name: leucine rich repeat containing 9
Synonyms: 4930432K16Rik, 4921529O18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78257
Homologene: 12692
Llgl1
Name: LLGL1 scribble cell polarity complex component
Synonyms: Lgl1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16897
HGNC: HGNC:6628
Homologene: 31220
Vmn2r118
Name: vomeronasal 2, receptor 118
Synonyms: EG668547, Vmn2r119, EG383258
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 383258
Homologene: 129687
Nlrp4e
Name: NLR family, pyrin domain containing 4E
Synonyms: Nalp-epsilon, Nalp4e, 4930406H16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 446099
Homologene: 75315
Ankub1
Name: ankyrin repeat and ubiquitin domain containing 1
Synonyms: LOC242037, Gm410
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242037
Homologene: 54680
Or52z12
Name: olfactory receptor family 52 subfamily Z member 12
Synonyms: GA_x6K02T2PBJ9-6306819-6307775, MOR31-10, Olfr617
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258838
Homologene: 105208
Exosc3
Name: exosome component 3
Synonyms: 2310005D06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66362
Homologene: 6867
Zfp663
Name: zinc finger protein 663
Synonyms: LOC381405, Gm1008
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381405
Homologene: 128277
Ubiad1
Name: UbiA prenyltransferase domain containing 1
Synonyms: Tere1, 1200002M06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71707
Homologene: 8336
Cited4
Name: Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4
Synonyms: Mrg2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56222
Homologene: 10474
Gm32742
Name: predicted gene, 32742
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102635385
Homologene: 132734
Gm45861
Name: predicted gene 45861
Type: Gene
Species: Mouse
Chromosome: 8
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 25,111,771 bp
  • A to T, chromosome 1 at 57,879,536 bp
  • A to G, chromosome 1 at 173,928,774 bp
  • A to G, chromosome 2 at 24,632,010 bp
  • A to T, chromosome 2 at 27,006,263 bp
  • G to T, chromosome 2 at 51,137,175 bp
  • A to G, chromosome 2 at 53,144,863 bp
  • G to C, chromosome 2 at 165,353,258 bp
  • A to T, chromosome 3 at 57,665,433 bp
  • T to A, chromosome 3 at 87,759,565 bp
  • G to T, chromosome 4 at 45,320,482 bp
  • C to A, chromosome 4 at 120,667,047 bp
  • GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC to GCCGCCGCAGCAGCC, chromosome 4 at 127,021,626 bp
  • T to C, chromosome 4 at 148,444,122 bp
  • A to G, chromosome 5 at 75,978,104 bp
  • A to T, chromosome 5 at 90,285,525 bp
  • A to T, chromosome 6 at 73,044,773 bp
  • G to A, chromosome 6 at 139,957,776 bp
  • A to C, chromosome 7 at 23,336,731 bp
  • T to C, chromosome 7 at 100,451,619 bp
  • A to T, chromosome 7 at 103,584,444 bp
  • A to G, chromosome 8 at 27,524,434 bp
  • T to C, chromosome 8 at 91,042,945 bp
  • A to G, chromosome 9 at 15,333,062 bp
  • A to G, chromosome 9 at 38,431,148 bp
  • A to G, chromosome 9 at 51,154,279 bp
  • C to A, chromosome 9 at 59,519,221 bp
  • A to T, chromosome 9 at 121,074,015 bp
  • C to T, chromosome 11 at 60,710,353 bp
  • A to T, chromosome 12 at 72,450,772 bp
  • T to C, chromosome 13 at 13,743,324 bp
  • T to C, chromosome 15 at 6,638,907 bp
  • T to A, chromosome 16 at 91,393,878 bp
  • C to A, chromosome 17 at 15,423,028 bp
  • T to A, chromosome 17 at 34,864,347 bp
  • C to T, chromosome 17 at 55,610,440 bp
  • A to G, chromosome 18 at 66,859,182 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6929 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045007-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.