Strain Name:
C57BL/6J-MtgxR1574Btlr/Mmmh
Stock Number:
045014-MU
Citation ID:
RRID:MMRRC_045014-MU
Other Names:
R1574 (G1)
Major Collection:

Strain Information

Cdon
Name: cell adhesion molecule-related/down-regulated by oncogenes
Synonyms: CAM-related/down-regulated by oncogenes, CDO
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57810
Homologene: 22996
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, D130075K09Rik, LEC3, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Lcmt1
Name: leucine carboxyl methyltransferase 1
Synonyms: Lcmt, LCMT-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 30949
Homologene: 41123
Slc6a4
Name: solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Synonyms: 5-HTT, Htt, Sert
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15567
Homologene: 817
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: ANCO-2, GAC-1, 2900001A12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106585
Homologene: 9059
Dnajc15
Name: DnaJ heat shock protein family (Hsp40) member C15
Synonyms: 1110003P16Rik, Dnajd1, MCJ
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66148
VEGA: 14
Homologene: 22740
Ddx19a
Name: DEAD box helicase 19a
Synonyms: Eif4a-rs1, DBP5, Ddx19, DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13680
Homologene: 5240
Zfp516
Name: zinc finger protein 516
Synonyms: C330029B10Rik, Zfp26l
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 329003
VEGA: 18
Homologene: 37122
Mcph1
Name: microcephaly, primary autosomal recessive 1
Synonyms: 5430437K10Rik, BRIT1, D030046N04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244329
HGNC: HGNC:6954
Homologene: 32586
Fndc3a
Name: fibronectin type III domain containing 3A
Synonyms: 1700094E19Rik, F730017H24Rik, D14Ertd453e, Fndc3, sys
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319448
Homologene: 8952
Kank2
Name: KN motif and ankyrin repeat domains 2
Synonyms: Ankrd25
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235041
VEGA: 9
Homologene: 9163
Ruvbl1
Name: RuvB-like AAA ATPase 1
Synonyms: Pontin52, 2510009G06Rik, Tip49a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56505
Homologene: 37839
Mdn1
Name: midasin AAA ATPase 1
Synonyms: LOC213784, 4833432B22Rik, D4Abb1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Cenpf
Name: centromere protein F
Synonyms: 6530404A22Rik, Lek1, mitosin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108000
HGNC: HGNC:1857
Homologene: 22969
Parp4
Name: poly (ADP-ribose) polymerase family, member 4
Synonyms: VPARP, VAULT3, p193, PH5P, E230037B21Rik, Adprtl1, C030027K23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328417
HGNC: HGNC:271
Homologene: 124423
Clock
Name: clock circadian regulator
Synonyms: 5330400M04Rik, KAT13D, bHLHe8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12753
HGNC: HGNC:2082
Homologene: 3603
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Atp2b1
Name: ATPase, Ca++ transporting, plasma membrane 1
Synonyms: PMCA1, E130111D10Rik, 2810442I22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67972
VEGA: 10
HGNC: HGNC:814
Homologene: 55597
Naca
Name: nascent polypeptide-associated complex alpha polypeptide
Synonyms: skNAC, LOC380777
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17938
VEGA: 10
HGNC: HGNC:7629
Homologene: 136025
Traf7
Name: TNF receptor-associated factor 7
Synonyms: RFWD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224619
Homologene: 12998
Srsf4
Name: serine and arginine-rich splicing factor 4
Synonyms: MNCb-2616, 5730499P16Rik, SRp75, Sfrs4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 57317
Homologene: 25624
Cacna2d3
Name: calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms: alpha 2 delta-3, alpha2delta3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12294
Homologene: 74929
Iqcd
Name: IQ motif containing D
Synonyms: 4933433C09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75732
Homologene: 49921
Drap1
Name: DR1 associated protein 1
Synonyms: 2310074H19Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66556
HGNC: HGNC:3019
Homologene: 4703
Zfp949
Name: zinc finger protein 949
Synonyms: 4930422I07Rik, Nczf
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71640
Homologene: 129930
Qtrt2
Name: queuine tRNA-ribosyltransferase accessory subunit 2
Synonyms: 3110012M05Rik, 4930470H18Rik, Qtrtd1, Qrtr2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106248
Homologene: 41576
Zfp653
Name: zinc finger protein 653
Synonyms: E430039K05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319601
VEGA: 9
Homologene: 16346
Moxd1
Name: monooxygenase, DBH-like 1
Synonyms: 3230402N08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 59012
Homologene: 22904
Anpep
Name: alanyl aminopeptidase, membrane
Synonyms: Cd13, aminopeptidase N, Apn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16790
HGNC: HGNC:500
Homologene: 68163
Apeh
Name: acylpeptide hydrolase
Synonyms: N-acylaminoacyl peptide hydrolase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235606
HGNC: HGNC:586
Homologene: 1240
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 665700
Homologene: 90772
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1537Clo, b2b1565Clo, b2b1154Clo, b2b1134Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: extraocular myosin, EO Myosin, MyHC-eo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b598Clo, b2b1727Clo, b2b1203Clo, b2b1279Clo, b2b1289Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Kmt5b
Name: lysine methyltransferase 5B
Synonyms: Suv4-20h1, C630029K18Rik, Suv420h1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225888
Homologene: 32351
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Vmn2r116
Name: vomeronasal 2, receptor 116
Synonyms: EG619697, V2Rp5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 619697
Homologene: 86604
Hc
Name: hemolytic complement
Synonyms: C5a, C5, He, Hfib2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15139
HGNC: HGNC:1331
Homologene: 20412
D430041D05Rik
Name: RIKEN cDNA D430041D05 gene
Synonyms: G2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241589
Homologene: 115928
Tdrd6
Name: tudor domain containing 6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210510
Homologene: 19364
Ddhd1
Name: DDHD domain containing 1
Synonyms: 9630061G18Rik, 4921528E07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 114874
Homologene: 35221
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Stk33
Name: serine/threonine kinase 33
Synonyms: 4921505G21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 117229
Homologene: 75307
Sfi1
Name: Sfi1 homolog, spindle assembly associated (yeast)
Synonyms: 2310047I15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78887
Homologene: 12707
Or13p3
Name: olfactory receptor family 13 subfamily P member 3
Synonyms: GA_x6K02T2QD9B-18838170-18837232, MOR258-1, Olfr1341
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258852
Homologene: 27281
Ces2b
Name: carboxyesterase 2B
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234669
HGNC: HGNC:1864
Homologene: 135851
Serpinb1c
Name: serine (or cysteine) peptidase inhibitor, clade B, member 1c
Synonyms: EIC, ovalbumin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380839
HGNC: HGNC:3311
Homologene: 137840
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Mtus2
Name: microtubule associated tumor suppressor candidate 2
Synonyms: 5730592G18Rik, A730013O20Rik, C130038G02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77521
Homologene: 78141
Kcng1
Name: potassium voltage-gated channel, subfamily G, member 1
Synonyms: OTTMUSG00000016048
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241794
HGNC: HGNC:6248
Homologene: 20515
Pcnx2
Name: pecanex homolog 2
Synonyms: E330039K12Rik, Pcnxl2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270109
HGNC: HGNC:8736
Homologene: 8987
Or13e8
Name: olfactory receptor family 13 subfamily E member 8
Synonyms: mOR6, MOR262-10, GA_x6K02T2N78B-16239704-16240654, Olfr70
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56014
Homologene: 10459
Tubb1
Name: tubulin, beta 1 class VI
Synonyms: 2810484G07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545486
Homologene: 69474
Als2cl
Name: ALS2 C-terminal like
Synonyms: mRn.49018, D930044G19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235633
Homologene: 17152
Sdk1
Name: sidekick cell adhesion molecule 1
Synonyms: 6720466O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330222
Homologene: 27395
Gm1110
Name: predicted gene 1110
Synonyms: LOC382064
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382064
VEGA: 9
Homologene: 78608
Gm5499
Name: predicted pseudogene 5499
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 433144
Or7a36
Name: olfactory receptor family 7 subfamily A member 36
Synonyms: GA_x6K02T2QGN0-2828447-2827518, MOR139-1, Olfr1352
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 259074
Homologene: 131141
Sart1
Name: squamous cell carcinoma antigen recognized by T cells 1
Synonyms: U5-110K
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20227
VEGA: 19
Homologene: 133770
Tmprss13
Name: transmembrane protease, serine 13
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214531
Homologene: 12936
Irag2
Name: inositol 1,4,5-triphosphate receptor associated 2
Synonyms: Jaw1, D6Int7, D6Int8, D6Int5, D6Int4, D6Int3, Lrmp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16970
HGNC: HGNC:6690
Homologene: 4483
Fam83e
Name: family with sequence similarity 83, member E
Synonyms: 4930403C10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73813
Homologene: 9791
Cenpo
Name: centromere protein O
Synonyms: D12Ertd482e, 8430427C03Rik, 2810429O05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52504
Homologene: 49760
Obox5
Name: oocyte specific homeobox 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252829
Homologene: 44937
Myrf
Name: myelin regulatory factor
Synonyms: LOC225908, LOC386531, Gm98
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225908
HGNC: HGNC:1181
Homologene: 32167
Slc24a5
Name: solute carrier family 24, member 5
Synonyms: NCX5, F630045L20Rik, NCKX5, Oca6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 317750
Homologene: 18400
Or2c1
Name: olfactory receptor family 2 subfamily C member 1
Synonyms: OR3, GA_x54KRFPKG5P-348087-349025, MOR256-17, Olfr15
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 18312
HGNC: HGNC:8242
Homologene: 7459
Tdpoz4
Name: TD and POZ domain containing 4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 399675
Homologene: 130121
Drgx
Name: dorsal root ganglia homeobox
Synonyms: Drg11, Prrxl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 107751
Gmnc
Name: geminin coiled-coil domain containing
Synonyms: LOC239789, LOC385639, Gm606
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239789
VEGA: 16
Homologene: 79940
Cdc25b
Name: cell division cycle 25B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12531
HGNC: HGNC:1726
Homologene: 41451
Or5ak20
Name: olfactory receptor family 5 subfamily AK member 20
Synonyms: GA_x6K02T2Q125-46830591-46829662, MOR203-5P, Olfr988
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258166
Homologene: 103791
Mad2l2
Name: MAD2 mitotic arrest deficient-like 2
Synonyms: MAD2B, REV7, 2310033C13Rik, G1-453-4, repro22
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71890
HGNC: HGNC:6764
Homologene: 4624
Sult1c2
Name: sulfotransferase family, cytosolic, 1C, member 2
Synonyms: ST1C1, 1810008N17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69083
Homologene: 38201
Or6c219
Name: olfactory receptor family 6 subfamily C member 219
Synonyms: GA_x6K02T2PULF-11624146-11623190, MOR110-2, Olfr818
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258773
Homologene: 74100
Zfp61
Name: zinc finger protein 61
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22719
Homologene: 74923
Vmn1r42
Name: vomeronasal 1 receptor 42
Synonyms: V1ra6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113848
Homologene: 130651
Vmn1r158
Name: vomeronasal 1 receptor 158
Synonyms: Gm16455
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043067
Homologene: 104166
Dbil5
Name: diazepam binding inhibitor-like 5
Synonyms: ELP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13168
Homologene: 10951
Fbxo48
Name: F-box protein 48
Synonyms: A630050E13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319701
Homologene: 18541
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 189,652,713 bp
  • A to C, chromosome 2 at 31,404,887 bp
  • G to A, chromosome 2 at 35,000,765 bp
  • A to T, chromosome 2 at 85,353,899 bp
  • GTGATGATGATGATGATGATG to GTGATGATGATGATGATG, chromosome 2 at 104,221,208 bp
  • G to A, chromosome 2 at 125,080,862 bp
  • T to A, chromosome 2 at 131,191,137 bp
  • T to A, chromosome 2 at 168,269,041 bp
  • T to C, chromosome 2 at 174,457,422 bp
  • T to A, chromosome 3 at 93,796,528 bp
  • A to G, chromosome 4 at 32,722,315 bp
  • A to T, chromosome 4 at 43,697,134 bp
  • T to A, chromosome 4 at 118,709,554 bp
  • T to A, chromosome 4 at 131,897,695 bp
  • G to T, chromosome 4 at 148,142,972 bp
  • A to G, chromosome 5 at 14,679,831 bp
  • T to C, chromosome 5 at 76,242,832 bp
  • T to A, chromosome 5 at 81,787,449 bp
  • A to G, chromosome 5 at 115,615,552 bp
  • A to T, chromosome 5 at 120,600,235 bp
  • A to G, chromosome 5 at 141,998,879 bp
  • A to C, chromosome 5 at 148,076,552 bp
  • T to C, chromosome 6 at 88,479,154 bp
  • A to G, chromosome 6 at 89,845,077 bp
  • C to T, chromosome 6 at 89,845,381 bp
  • T to G, chromosome 6 at 145,158,630 bp
  • T to C, chromosome 7 at 15,758,633 bp
  • A to T, chromosome 7 at 22,790,347 bp
  • C to G, chromosome 7 at 24,291,210 bp
  • G to A, chromosome 7 at 45,726,711 bp
  • A to G, chromosome 7 at 79,838,407 bp
  • C to T, chromosome 7 at 109,279,820 bp
  • T to A, chromosome 7 at 123,402,908 bp
  • T to C, chromosome 8 at 18,801,412 bp
  • G to T, chromosome 8 at 104,835,889 bp
  • A to G, chromosome 8 at 109,614,813 bp
  • T to C, chromosome 8 at 110,993,111 bp
  • G to A, chromosome 8 at 125,773,930 bp
  • A to G, chromosome 9 at 21,774,575 bp
  • C to A, chromosome 9 at 22,057,978 bp
  • G to T, chromosome 9 at 26,881,126 bp
  • A to G, chromosome 9 at 35,452,937 bp
  • C to A, chromosome 9 at 45,343,231 bp
  • A to T, chromosome 9 at 88,569,777 bp
  • A to T, chromosome 9 at 108,092,726 bp
  • A to G, chromosome 9 at 110,884,060 bp
  • T to C, chromosome 10 at 24,300,319 bp
  • T to A, chromosome 10 at 27,324,754 bp
  • T to C, chromosome 10 at 30,694,101 bp
  • C to A, chromosome 10 at 78,983,986 bp
  • T to A, chromosome 10 at 98,996,948 bp
  • G to T, chromosome 10 at 128,040,398 bp
  • A to G, chromosome 10 at 129,945,510 bp
  • TCGC to TC, chromosome 11 at 3,146,254 bp
  • G to T, chromosome 11 at 16,953,368 bp
  • T to C, chromosome 11 at 67,362,581 bp
  • A to G, chromosome 11 at 69,514,688 bp
  • A to G, chromosome 11 at 76,218,482 bp
  • A to T, chromosome 11 at 77,019,196 bp
  • A to T, chromosome 12 at 4,215,433 bp
  • A to T, chromosome 12 at 7,990,839 bp
  • A to G, chromosome 12 at 118,060,317 bp
  • T to C, chromosome 13 at 32,888,996 bp
  • T to A, chromosome 14 at 29,351,822 bp
  • A to G, chromosome 14 at 32,605,324 bp
  • A to C, chromosome 14 at 45,595,547 bp
  • A to G, chromosome 14 at 56,602,295 bp
  • A to T, chromosome 14 at 72,556,557 bp
  • A to T, chromosome 14 at 77,826,414 bp
  • T to A, chromosome 15 at 28,252,423 bp
  • T to C, chromosome 15 at 47,695,861 bp
  • T to C, chromosome 16 at 3,839,657 bp
  • G to T, chromosome 16 at 26,963,979 bp
  • A to G, chromosome 16 at 43,871,832 bp
  • A to T, chromosome 17 at 23,387,089 bp
  • A to G, chromosome 17 at 24,510,553 bp
  • G to A, chromosome 17 at 43,625,624 bp
  • A to G, chromosome 17 at 53,836,899 bp
  • A to T, chromosome 17 at 65,986,274 bp
  • T to C, chromosome 17 at 87,078,995 bp
  • A to G, chromosome 18 at 10,554,997 bp
  • T to A, chromosome 18 at 82,993,175 bp
  • T to A, chromosome 19 at 3,786,633 bp
  • G to A, chromosome 19 at 5,380,259 bp
  • A to G, chromosome 19 at 5,424,257 bp
  • T to C, chromosome 19 at 10,225,487 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1574 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045014-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.