Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1574Btlr/Mmmh
Stock Number:
045014-MU
Citation ID:
RRID:MMRRC_045014-MU
Other Names:
R1574 (G1)
Major Collection:

Strain Information

Cdon
Name: cell adhesion molecule-related/down-regulated by oncogenes
Synonyms: CAM-related/down-regulated by oncogenes, CDO
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57810
Homologene: 22996
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Lcmt1
Name: leucine carboxyl methyltransferase 1
Synonyms: Lcmt, LCMT-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 30949
Homologene: 41123
Slc6a4
Name: solute carrier family 6 (neurotransmitter transporter, serotonin), member 4
Synonyms: 5-HTT, Htt, Sert
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15567
Homologene: 817
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: ANCO-2, GAC-1, 2900001A12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106585
Homologene: 9059
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 189,652,713 bp
  • A to C, chromosome 2 at 31,404,887 bp
  • G to A, chromosome 2 at 35,000,765 bp
  • A to T, chromosome 2 at 85,353,899 bp
  • GTGATGATGATGATGATGATG to GTGATGATGATGATGATG, chromosome 2 at 104,221,208 bp
  • G to A, chromosome 2 at 125,080,862 bp
  • T to A, chromosome 2 at 131,191,137 bp
  • T to A, chromosome 2 at 168,269,041 bp
  • T to C, chromosome 2 at 174,457,422 bp
  • T to A, chromosome 3 at 93,796,528 bp
  • A to G, chromosome 4 at 32,722,315 bp
  • A to T, chromosome 4 at 43,697,134 bp
  • T to A, chromosome 4 at 118,709,554 bp
  • T to A, chromosome 4 at 131,897,695 bp
  • G to T, chromosome 4 at 148,142,972 bp
  • A to G, chromosome 5 at 14,679,831 bp
  • T to C, chromosome 5 at 76,242,832 bp
  • T to A, chromosome 5 at 81,787,449 bp
  • A to G, chromosome 5 at 115,615,552 bp
  • A to T, chromosome 5 at 120,600,235 bp
  • A to G, chromosome 5 at 141,998,879 bp
  • A to C, chromosome 5 at 148,076,552 bp
  • T to C, chromosome 6 at 88,479,154 bp
  • A to G, chromosome 6 at 89,845,077 bp
  • C to T, chromosome 6 at 89,845,381 bp
  • T to G, chromosome 6 at 145,158,630 bp
  • T to C, chromosome 7 at 15,758,633 bp
  • A to T, chromosome 7 at 22,790,347 bp
  • C to G, chromosome 7 at 24,291,210 bp
  • G to A, chromosome 7 at 45,726,711 bp
  • A to G, chromosome 7 at 79,838,407 bp
  • C to T, chromosome 7 at 109,279,820 bp
  • T to A, chromosome 7 at 123,402,908 bp
  • T to C, chromosome 8 at 18,801,412 bp
  • G to T, chromosome 8 at 104,835,889 bp
  • A to G, chromosome 8 at 109,614,813 bp
  • T to C, chromosome 8 at 110,993,111 bp
  • G to A, chromosome 8 at 125,773,930 bp
  • A to G, chromosome 9 at 21,774,575 bp
  • C to A, chromosome 9 at 22,057,978 bp
  • G to T, chromosome 9 at 26,881,126 bp
  • A to G, chromosome 9 at 35,452,937 bp
  • C to A, chromosome 9 at 45,343,231 bp
  • A to T, chromosome 9 at 88,569,777 bp
  • A to T, chromosome 9 at 108,092,726 bp
  • A to G, chromosome 9 at 110,884,060 bp
  • T to C, chromosome 10 at 24,300,319 bp
  • T to A, chromosome 10 at 27,324,754 bp
  • T to C, chromosome 10 at 30,694,101 bp
  • C to A, chromosome 10 at 78,983,986 bp
  • T to A, chromosome 10 at 98,996,948 bp
  • G to T, chromosome 10 at 128,040,398 bp
  • A to G, chromosome 10 at 129,945,510 bp
  • TCGC to TC, chromosome 11 at 3,146,254 bp
  • G to T, chromosome 11 at 16,953,368 bp
  • T to C, chromosome 11 at 67,362,581 bp
  • A to G, chromosome 11 at 69,514,688 bp
  • A to G, chromosome 11 at 76,218,482 bp
  • A to T, chromosome 11 at 77,019,196 bp
  • A to T, chromosome 12 at 4,215,433 bp
  • A to T, chromosome 12 at 7,990,839 bp
  • A to G, chromosome 12 at 118,060,317 bp
  • T to C, chromosome 13 at 32,888,996 bp
  • T to A, chromosome 14 at 29,351,822 bp
  • A to G, chromosome 14 at 32,605,324 bp
  • A to C, chromosome 14 at 45,595,547 bp
  • A to G, chromosome 14 at 56,602,295 bp
  • A to T, chromosome 14 at 72,556,557 bp
  • A to T, chromosome 14 at 77,826,414 bp
  • T to A, chromosome 15 at 28,252,423 bp
  • T to C, chromosome 15 at 47,695,861 bp
  • T to C, chromosome 16 at 3,839,657 bp
  • G to T, chromosome 16 at 26,963,979 bp
  • A to G, chromosome 16 at 43,871,832 bp
  • A to T, chromosome 17 at 23,387,089 bp
  • A to G, chromosome 17 at 24,510,553 bp
  • G to A, chromosome 17 at 43,625,624 bp
  • A to G, chromosome 17 at 53,836,899 bp
  • A to T, chromosome 17 at 65,986,274 bp
  • T to C, chromosome 17 at 87,078,995 bp
  • A to G, chromosome 18 at 10,554,997 bp
  • T to A, chromosome 18 at 82,993,175 bp
  • T to A, chromosome 19 at 3,786,633 bp
  • G to A, chromosome 19 at 5,380,259 bp
  • A to G, chromosome 19 at 5,424,257 bp
  • T to C, chromosome 19 at 10,225,487 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1574 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045014-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.