Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR1839Btlr/Mmmh
Stock Number:
045015-MU
Citation ID:
RRID:MMRRC_045015-MU
Other Names:
R1839 (G1)
Major Collection:

Strain Information

Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Adgre1
Name: adhesion G protein-coupled receptor E1
Synonyms: F4/80, DD7A5-7, TM7LN3, EGF-TM7, Ly71, Emr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13733
VEGA: 17
HGNC: HGNC:3336
Homologene: 1493
Rgs14
Name: regulator of G-protein signaling 14
Synonyms: Rap1/rap2 interacting protein
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 51791
HGNC: HGNC:9996
Homologene: 4735
Uri1
Name: URI1, prefoldin-like chaperone
Synonyms: NNX3, Rmp, C80913
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19777
Homologene: 2813
Trim59
Name: tripartite motif-containing 59
Synonyms: 2700022F13Rik, TSBF1, Mrf1, 2310035M22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66949
Homologene: 32644
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Zfp523
Name: zinc finger protein 523
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224656
Homologene: 2569
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 93,750,287 bp
  • C to A, chromosome 1 at 130,414,105 bp
  • T to C, chromosome 1 at 134,837,981 bp
  • T to C, chromosome 1 at 173,589,600 bp
  • T to A, chromosome 2 at 26,007,738 bp
  • T to C, chromosome 2 at 76,861,495 bp
  • T to C, chromosome 2 at 77,011,665 bp
  • A to T, chromosome 2 at 120,325,397 bp
  • C to A, chromosome 2 at 126,361,782 bp
  • T to A, chromosome 2 at 144,279,487 bp
  • C to A, chromosome 2 at 148,395,533 bp
  • T to C, chromosome 2 at 164,429,012 bp
  • T to C, chromosome 2 at 170,496,741 bp
  • CTTT to CTT, chromosome 3 at 54,789,179 bp
  • A to G, chromosome 3 at 59,068,319 bp
  • A to T, chromosome 3 at 69,037,638 bp
  • G to A, chromosome 3 at 95,119,218 bp
  • T to C, chromosome 3 at 98,619,728 bp
  • T to C, chromosome 3 at 124,409,720 bp
  • C to A, chromosome 3 at 134,240,653 bp
  • T to C, chromosome 4 at 43,258,308 bp
  • T to C, chromosome 4 at 139,360,485 bp
  • T to C, chromosome 4 at 141,713,526 bp
  • A to T, chromosome 5 at 20,465,827 bp
  • T to C, chromosome 5 at 33,389,752 bp
  • C to A, chromosome 5 at 121,501,041 bp
  • T to C, chromosome 5 at 140,762,612 bp
  • T to A, chromosome 5 at 145,381,301 bp
  • T to A, chromosome 6 at 35,219,714 bp
  • T to C, chromosome 6 at 66,805,233 bp
  • G to A, chromosome 7 at 27,910,356 bp
  • A to T, chromosome 7 at 37,967,389 bp
  • T to C, chromosome 7 at 84,856,548 bp
  • T to C, chromosome 8 at 35,590,858 bp
  • A to G, chromosome 8 at 89,028,716 bp
  • T to C, chromosome 8 at 105,849,014 bp
  • A to G, chromosome 8 at 106,913,454 bp
  • T to C, chromosome 8 at 111,485,340 bp
  • A to G, chromosome 9 at 37,422,327 bp
  • C to T, chromosome 9 at 51,849,326 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • G to A, chromosome 9 at 105,864,833 bp
  • G to A, chromosome 9 at 107,583,017 bp
  • A to G, chromosome 9 at 108,829,906 bp
  • A to G, chromosome 10 at 53,541,553 bp
  • A to G, chromosome 10 at 80,727,108 bp
  • T to C, chromosome 11 at 29,154,342 bp
  • T to C, chromosome 11 at 31,182,386 bp
  • A to T, chromosome 11 at 58,529,373 bp
  • A to G, chromosome 11 at 60,753,888 bp
  • A to G, chromosome 11 at 69,130,085 bp
  • A to T, chromosome 11 at 83,297,822 bp
  • A to G, chromosome 11 at 86,789,297 bp
  • C to T, chromosome 11 at 98,629,858 bp
  • A to G, chromosome 11 at 98,756,143 bp
  • A to G, chromosome 11 at 101,163,600 bp
  • A to T, chromosome 11 at 106,784,897 bp
  • A to T, chromosome 11 at 116,600,191 bp
  • C to T, chromosome 12 at 79,078,957 bp
  • A to G, chromosome 12 at 108,195,074 bp
  • G to A, chromosome 12 at 109,035,323 bp
  • A to G, chromosome 13 at 21,312,327 bp
  • T to C, chromosome 13 at 30,906,497 bp
  • T to C, chromosome 13 at 55,382,838 bp
  • C to T, chromosome 13 at 68,689,261 bp
  • C to A, chromosome 13 at 99,228,492 bp
  • T to C, chromosome 14 at 52,204,883 bp
  • T to C, chromosome 14 at 54,973,180 bp
  • C to A, chromosome 14 at 65,016,530 bp
  • T to C, chromosome 14 at 68,639,210 bp
  • A to T, chromosome 14 at 89,897,836 bp
  • A to G, chromosome 15 at 91,683,134 bp
  • C to T, chromosome 15 at 101,937,938 bp
  • G to T, chromosome 16 at 17,342,992 bp
  • A to T, chromosome 16 at 26,524,821 bp
  • G to C, chromosome 16 at 32,753,919 bp
  • A to T, chromosome 16 at 35,248,940 bp
  • T to A, chromosome 16 at 87,416,264 bp
  • T to A, chromosome 17 at 12,928,606 bp
  • A to T, chromosome 17 at 26,092,097 bp
  • T to A, chromosome 17 at 28,194,993 bp
  • C to T, chromosome 17 at 34,188,109 bp
  • T to C, chromosome 17 at 57,441,299 bp
  • T to C, chromosome 18 at 38,199,485 bp
  • A to G, chromosome 19 at 6,854,109 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1839 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045015-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.