Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6973Btlr/Mmmh
Stock Number:
045083-MU
Citation ID:
RRID:MMRRC_045083-MU
Other Names:
R6973 (G1)
Major Collection:

Strain Information

Tert
Name: telomerase reverse transcriptase
Synonyms: TR
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21752
VEGA: 13
Homologene: 31141
Ntrk1
Name: neurotrophic tyrosine kinase, receptor, type 1
Synonyms: TrkA, Tkr
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18211
HGNC: HGNC:8031
Homologene: 1898
Dgka
Name: diacylglycerol kinase, alpha
Synonyms: Dagk1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13139
VEGA: 10
HGNC: HGNC:2849
Homologene: 1028
Ireb2
Name: iron responsive element binding protein 2
Synonyms: Irp2, D9Ertd85e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64602
VEGA: 9
HGNC: HGNC:6115
Homologene: 11280
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109294
Homologene: 23523
Znfx1
Name: zinc finger, NFX1-type containing 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98999
Homologene: 10877
Exoc4
Name: exocyst complex component 4
Synonyms: Sec8, Sec8l1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20336
Homologene: 40654
Akap9
Name: A kinase anchor protein 9
Synonyms: AKAP450, 5730481H23Rik, G1-448-15, repro12, mei2-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100986
HGNC: HGNC:379
Homologene: 134583
Chd4
Name: chromodomain helicase DNA binding protein 4
Synonyms: D6Ertd380e, 9530019N15Rik, Mi-2beta
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107932
HGNC: HGNC:1919
Homologene: 68175
Atp6v1c1
Name: ATPase, H+ transporting, lysosomal V1 subunit C1
Synonyms: 1700025B18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66335
VEGA: 15
HGNC: HGNC:856
Homologene: 1281
Gpbp1l1
Name: GC-rich promoter binding protein 1-like 1
Synonyms: 5330440M15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77110
Homologene: 84840
Dcdc2a
Name: doublecortin domain containing 2a
Synonyms: RU2, Dcdc2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 195208
Homologene: 9483
Adamts12
Name: ADAM metallopeptidase with thrombospondin type 1 motif 12
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239337
VEGA: 15
Homologene: 12808
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Nos3
Name: nitric oxide synthase 3, endothelial cell
Synonyms: eNOS, ecNOS, Nos-3, 2310065A03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18127
HGNC: HGNC:7876
Homologene: 504
Cd244a
Name: CD244 molecule A
Synonyms: 2B4, C9.1, Nmrk, F730046O15Rik, Cd244
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18106
Homologene: 9493
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: oxygen-regulated protein 1, Orp1, mG145, Dcdc3, Rp1h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Unc79
Name: unc-79 homolog
Synonyms: 9030205A07Rik, Mlca3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217843
Homologene: 41397
Mybpc1
Name: myosin binding protein C, slow-type
Synonyms: Slow-type C-protein, 8030451F13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 109272
HGNC: HGNC:7549
Homologene: 1846
Nfic
Name: nuclear factor I/C
Synonyms: NF1-C, 1500041O16Rik, 1110019L22Rik, nuclear factor 1-C2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18029
HGNC: HGNC:7786
Homologene: 4088
Or52h7
Name: olfactory receptor family 52 subfamily H member 7
Synonyms: GA_x6K02T2PBJ9-7191524-7192471, MOR31-8, Olfr652
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259050
Homologene: 17477
Etv2
Name: ets variant 2
Synonyms: Etsrp71
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14008
HGNC: HGNC:3491
Homologene: 7308
Pcdhb2
Name: protocadherin beta 2
Synonyms: PcdhbB
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93873
HGNC: HGNC:8687
Homologene: 69266
Zfp687
Name: zinc finger protein 687
Synonyms: 4931408L03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78266
Homologene: 10827
Smarca5
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms: Snf2h, D330027N15Rik, 4933427E24Rik, D030040M08Rik, MommeD4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93762
Homologene: 55764
Tcn2
Name: transcobalamin 2
Synonyms: Tcn-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21452
Homologene: 303
B3gnt7
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
Synonyms: beta-3GnT7, C330001H22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227327
Homologene: 17049
Prelid3b
Name: PRELI domain containing 3B
Synonyms: 2310042G06Rik, Slmo2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66390
Homologene: 56106
Aadacl3
Name: arylacetamide deacetylase like 3
Synonyms: LOC230883
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230883
Homologene: 28426
Ephb4
Name: Eph receptor B4
Synonyms: MDK2, Myk1, Htk, Tyro11, b2b2412Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13846
HGNC: HGNC:3395
Homologene: 20939
Spata31d1e
Name: spermatogenesis associated 31 subfamily D, member 1E
Synonyms: 1700014D04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 102638268
Homologene: 140986
Gatad1
Name: GATA zinc finger domain containing 1
Synonyms: 2810047M21Rik, 2310031E19Rik, B330017N08Rik, 8430439A17Rik, Odag, 9130430G15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67210
Homologene: 56916
Rspo4
Name: R-spondin 4
Synonyms: A930029K19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228770
Homologene: 65290
Tnni3
Name: troponin I, cardiac 3
Synonyms: Tn1, cardiac troponin I, cTnI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21954
Homologene: 309
C2cd4d
Name: C2 calcium-dependent domain containing 4D
Synonyms: LOC271944, Gm659
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 271944
Homologene: 86310
Pcdhgb6
Name: protocadherin gamma subfamily B, 6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93703
HGNC: HGNC:8713
Homologene: 49573
Or8u3-ps
Name: olfactory receptor family 8 subfamily U member 3
Synonyms: GA_x6K02T2Q125-47591072-47592031, MOR185-3, Olfr1038-ps
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259015
Homologene: 17463
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 4,351,994 bp
  • T to G, chromosome 1 at 11,112,743 bp
  • G to A, chromosome 1 at 86,305,387 bp
  • A to G, chromosome 1 at 171,574,207 bp
  • A to G, chromosome 2 at 13,381,837 bp
  • C to T, chromosome 2 at 86,122,854 bp
  • C to A, chromosome 2 at 112,766,311 bp
  • T to A, chromosome 2 at 151,867,815 bp
  • T to A, chromosome 2 at 167,056,761 bp
  • C to A, chromosome 2 at 174,469,362 bp
  • A to T, chromosome 3 at 87,783,981 bp
  • G to T, chromosome 3 at 94,363,823 bp
  • A to G, chromosome 3 at 95,009,377 bp
  • A to G, chromosome 4 at 116,581,282 bp
  • T to C, chromosome 4 at 144,456,190 bp
  • T to C, chromosome 5 at 3,643,540 bp
  • A to G, chromosome 5 at 4,046,699 bp
  • A to T, chromosome 5 at 24,380,243 bp
  • T to G, chromosome 5 at 137,369,804 bp
  • CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC to CATC, chromosome 6 at 4,756,431 bp
  • G to T, chromosome 6 at 33,580,030 bp
  • A to G, chromosome 6 at 125,122,862 bp
  • A to G, chromosome 7 at 4,518,417 bp
  • T to C, chromosome 7 at 30,634,742 bp
  • G to A, chromosome 7 at 104,564,976 bp
  • A to G, chromosome 8 at 80,704,751 bp
  • A to G, chromosome 9 at 54,882,387 bp
  • C to A, chromosome 10 at 81,420,357 bp
  • T to C, chromosome 10 at 88,560,361 bp
  • C to T, chromosome 10 at 128,729,594 bp
  • T to C, chromosome 11 at 3,917,649 bp
  • T to C, chromosome 12 at 102,998,440 bp
  • A to T, chromosome 13 at 25,120,389 bp
  • A to G, chromosome 13 at 59,742,707 bp
  • A to G, chromosome 13 at 73,627,988 bp
  • T to A, chromosome 15 at 11,331,780 bp
  • A to G, chromosome 15 at 38,690,550 bp
  • G to C, chromosome 18 at 37,296,363 bp
  • A to T, chromosome 18 at 37,742,473 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6973 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045083-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.