Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7017Btlr/Mmmh
Stock Number:
045118-MU
Citation ID:
RRID:MMRRC_045118-MU
Other Names:
R7017 (G1)
Major Collection:

Strain Information

St8sia1
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Synonyms: alpha-2,8-sialyltransferase, ST8Sia I, GD3S, GD3 synthase, Siat8, Siat8a, 9330109E03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20449
Homologene: 2282
Drd2
Name: dopamine receptor D2
Synonyms: D2 receptor, D2R, Drd-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13489
VEGA: 9
HGNC: HGNC:3023
Homologene: 22561
Met
Name: met proto-oncogene
Synonyms: HGF receptor, c-Met, Par4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17295
HGNC: HGNC:7029
Homologene: 206
Kera
Name: keratocan
Synonyms: SLRR2B, CNA2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16545
VEGA: 10
HGNC: HGNC:6309
Homologene: 5106
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Thbs3
Name: thrombospondin 3
Synonyms: Thbs-3, TSP3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21827
Homologene: 5159
Wwp1
Name: WW domain containing E3 ubiquitin protein ligase 1
Synonyms: SDRP1, Tiul1, AIP5, 8030445B08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107568
Homologene: 21385
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 126,102,661 bp
  • T to C, chromosome 1 at 136,095,858 bp
  • T to A, chromosome 2 at 85,608,329 bp
  • T to A, chromosome 2 at 153,329,724 bp
  • C to A, chromosome 2 at 158,448,337 bp
  • A to T, chromosome 2 at 160,758,097 bp
  • T to C, chromosome 2 at 167,048,534 bp
  • C to G, chromosome 2 at 180,976,304 bp
  • C to A, chromosome 3 at 10,194,696 bp
  • C to T, chromosome 3 at 30,645,316 bp
  • G to A, chromosome 3 at 38,891,543 bp
  • T to C, chromosome 3 at 53,519,602 bp
  • C to A, chromosome 3 at 87,366,061 bp
  • A to T, chromosome 3 at 89,224,415 bp
  • T to C, chromosome 3 at 90,527,295 bp
  • T to C, chromosome 3 at 94,854,024 bp
  • T to A, chromosome 3 at 108,374,838 bp
  • T to C, chromosome 3 at 152,846,403 bp
  • T to C, chromosome 4 at 19,623,124 bp
  • T to A, chromosome 4 at 45,940,934 bp
  • T to C, chromosome 4 at 47,410,728 bp
  • T to A, chromosome 4 at 63,345,211 bp
  • T to C, chromosome 4 at 133,486,234 bp
  • G to A, chromosome 4 at 134,347,415 bp
  • T to A, chromosome 4 at 139,393,090 bp
  • GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG to GAGACAACGCGAGGCCGAGAGGCAGG, chromosome 5 at 76,856,948 bp
  • T to C, chromosome 5 at 107,406,114 bp
  • T to A, chromosome 6 at 17,491,287 bp
  • T to A, chromosome 6 at 88,908,312 bp
  • A to G, chromosome 6 at 132,847,550 bp
  • C to A, chromosome 6 at 142,867,906 bp
  • G to T, chromosome 7 at 3,908,708 bp
  • C to A, chromosome 7 at 18,724,441 bp
  • A to T, chromosome 7 at 45,358,800 bp
  • T to A, chromosome 7 at 48,552,837 bp
  • T to A, chromosome 7 at 120,663,002 bp
  • G to C, chromosome 7 at 141,809,687 bp
  • T to C, chromosome 8 at 124,863,275 bp
  • A to G, chromosome 9 at 20,618,320 bp
  • G to T, chromosome 9 at 45,047,289 bp
  • G to A, chromosome 9 at 49,400,829 bp
  • T to A, chromosome 9 at 106,515,664 bp
  • T to C, chromosome 9 at 121,965,986 bp
  • A to T, chromosome 10 at 97,609,077 bp
  • A to G, chromosome 10 at 127,763,037 bp
  • G to A, chromosome 11 at 17,052,220 bp
  • T to A, chromosome 11 at 36,171,409 bp
  • T to A, chromosome 11 at 69,491,547 bp
  • A to G, chromosome 11 at 105,923,108 bp
  • A to G, chromosome 12 at 31,943,853 bp
  • A to T, chromosome 12 at 84,053,303 bp
  • T to A, chromosome 12 at 114,879,913 bp
  • G to A, chromosome 13 at 21,291,391 bp
  • A to G, chromosome 13 at 38,186,707 bp
  • T to A, chromosome 13 at 94,224,915 bp
  • C to T, chromosome 13 at 112,601,488 bp
  • T to G, chromosome 14 at 23,494,643 bp
  • T to C, chromosome 14 at 26,735,680 bp
  • T to C, chromosome 14 at 41,383,653 bp
  • T to A, chromosome 14 at 55,704,941 bp
  • A to T, chromosome 15 at 76,173,541 bp
  • T to C, chromosome 15 at 80,380,470 bp
  • A to T, chromosome 15 at 82,760,033 bp
  • A to G, chromosome 16 at 17,209,746 bp
  • T to C, chromosome 16 at 22,572,713 bp
  • C to T, chromosome 16 at 30,272,962 bp
  • T to C, chromosome 16 at 36,970,370 bp
  • C to T, chromosome 17 at 17,877,392 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • A to G, chromosome 17 at 36,978,034 bp
  • A to G, chromosome 17 at 42,502,735 bp
  • T to C, chromosome 17 at 46,550,904 bp
  • A to G, chromosome 18 at 46,850,678 bp
  • C to T, chromosome 18 at 61,081,004 bp
  • C to T, chromosome 19 at 4,460,867 bp
  • T to A, chromosome 19 at 53,233,853 bp
  • G to T, chromosome 19 at 59,345,352 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7017 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045118-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.