Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7038Btlr/Mmmh
Stock Number:
045138-MU
Citation ID:
RRID:MMRRC_045138-MU
Other Names:
R7038 (G1)
Major Collection:

Strain Information

Cd4
Name: CD4 antigen
Synonyms: L3T4, Ly-4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12504
HGNC: HGNC:1678
Homologene: 513
Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: paladin, X99384
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27355
VEGA: 10
Homologene: 8453
Tbx21
Name: T-box 21
Synonyms: Tblym, TBT1, T-bet, Tbet
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57765
Homologene: 8353
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Pds5b
Name: PDS5 cohesin associated factor B
Synonyms: AS3, Aprin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100710
Homologene: 41001
Hspa12a
Name: heat shock protein 12A
Synonyms: Hspa12a, 1700063D12Rik, Gm19925
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73442
VEGA: 19
Homologene: 18422
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 34,182,798 bp
  • T to A, chromosome 1 at 34,459,825 bp
  • C to A, chromosome 1 at 59,167,514 bp
  • T to A, chromosome 1 at 63,731,873 bp
  • T to C, chromosome 1 at 65,234,361 bp
  • T to C, chromosome 1 at 87,089,111 bp
  • T to C, chromosome 1 at 90,603,598 bp
  • T to C, chromosome 1 at 117,853,599 bp
  • C to A, chromosome 1 at 131,842,057 bp
  • T to C, chromosome 1 at 132,454,109 bp
  • T to C, chromosome 1 at 156,641,409 bp
  • T to A, chromosome 1 at 192,983,658 bp
  • A to T, chromosome 2 at 70,095,208 bp
  • A to T, chromosome 2 at 88,678,741 bp
  • A to G, chromosome 2 at 120,993,577 bp
  • A to G, chromosome 2 at 127,600,866 bp
  • A to G, chromosome 2 at 150,917,871 bp
  • G to T, chromosome 2 at 154,202,669 bp
  • C to A, chromosome 2 at 155,944,735 bp
  • A to G, chromosome 2 at 163,314,344 bp
  • A to T, chromosome 2 at 167,485,363 bp
  • C to A, chromosome 2 at 180,333,892 bp
  • C to T, chromosome 3 at 27,501,469 bp
  • A to T, chromosome 3 at 88,982,671 bp
  • T to A, chromosome 3 at 90,159,947 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • T to G, chromosome 3 at 94,763,085 bp
  • C to A, chromosome 3 at 99,984,609 bp
  • T to A, chromosome 3 at 122,276,532 bp
  • A to G, chromosome 3 at 138,527,182 bp
  • G to T, chromosome 4 at 3,904,676 bp
  • A to G, chromosome 4 at 34,816,357 bp
  • A to G, chromosome 4 at 48,672,479 bp
  • T to A, chromosome 4 at 96,535,471 bp
  • A to G, chromosome 4 at 115,857,110 bp
  • T to A, chromosome 4 at 124,728,426 bp
  • G to C, chromosome 4 at 154,990,032 bp
  • T to C, chromosome 5 at 30,120,000 bp
  • A to T, chromosome 5 at 90,609,725 bp
  • A to G, chromosome 5 at 92,298,190 bp
  • T to A, chromosome 5 at 111,266,579 bp
  • G to A, chromosome 5 at 115,611,144 bp
  • T to C, chromosome 5 at 120,585,277 bp
  • A to G, chromosome 5 at 121,299,597 bp
  • G to T, chromosome 5 at 150,800,760 bp
  • G to T, chromosome 6 at 47,866,309 bp
  • T to C, chromosome 6 at 48,438,138 bp
  • C to T, chromosome 6 at 87,653,823 bp
  • C to T, chromosome 6 at 124,870,254 bp
  • T to A, chromosome 6 at 135,023,373 bp
  • T to G, chromosome 7 at 55,805,366 bp
  • T to A, chromosome 7 at 97,303,083 bp
  • T to C, chromosome 8 at 25,641,263 bp
  • A to G, chromosome 8 at 28,715,721 bp
  • A to T, chromosome 8 at 34,851,636 bp
  • T to A, chromosome 9 at 18,620,468 bp
  • A to C, chromosome 9 at 19,441,592 bp
  • T to C, chromosome 9 at 57,545,217 bp
  • A to T, chromosome 9 at 58,823,584 bp
  • C to T, chromosome 9 at 78,109,202 bp
  • T to A, chromosome 9 at 81,632,243 bp
  • A to G, chromosome 9 at 105,945,738 bp
  • T to A, chromosome 9 at 109,100,385 bp
  • T to C, chromosome 9 at 123,173,597 bp
  • T to C, chromosome 10 at 12,682,338 bp
  • T to C, chromosome 10 at 61,339,299 bp
  • A to T, chromosome 10 at 86,695,866 bp
  • T to C, chromosome 10 at 89,600,221 bp
  • T to C, chromosome 11 at 59,589,582 bp
  • C to A, chromosome 11 at 75,390,514 bp
  • T to A, chromosome 11 at 75,496,158 bp
  • A to G, chromosome 11 at 87,035,292 bp
  • A to G, chromosome 11 at 97,099,771 bp
  • A to G, chromosome 11 at 105,332,236 bp
  • A to T, chromosome 11 at 106,511,900 bp
  • A to G, chromosome 11 at 118,332,989 bp
  • C to T, chromosome 12 at 28,751,818 bp
  • A to G, chromosome 13 at 24,139,335 bp
  • A to G, chromosome 13 at 24,893,408 bp
  • C to T, chromosome 13 at 46,752,455 bp
  • A to G, chromosome 13 at 55,004,484 bp
  • G to T, chromosome 13 at 63,190,525 bp
  • G to A, chromosome 13 at 67,293,933 bp
  • G to A, chromosome 13 at 91,982,833 bp
  • A to G, chromosome 13 at 95,444,191 bp
  • T to A, chromosome 15 at 59,496,830 bp
  • T to C, chromosome 15 at 81,008,375 bp
  • T to C, chromosome 16 at 13,826,910 bp
  • C to T, chromosome 16 at 17,652,727 bp
  • A to T, chromosome 16 at 21,976,259 bp
  • T to C, chromosome 16 at 87,424,871 bp
  • T to C, chromosome 17 at 12,698,325 bp
  • T to A, chromosome 17 at 19,505,001 bp
  • G to A, chromosome 17 at 25,243,840 bp
  • T to G, chromosome 18 at 36,760,420 bp
  • A to T, chromosome 18 at 37,342,204 bp
  • A to T, chromosome 18 at 78,159,037 bp
  • A to G, chromosome 18 at 84,561,857 bp
  • A to T, chromosome 19 at 6,014,319 bp
  • A to T, chromosome 19 at 11,110,311 bp
  • A to T, chromosome 19 at 13,768,351 bp
  • G to A, chromosome 19 at 39,287,127 bp
  • A to G, chromosome 19 at 58,804,700 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7038 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045138-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.