Strain Name:
C57BL/6J-MtgxR7038Btlr/Mmmh
Stock Number:
045138-MU
Citation ID:
RRID:MMRRC_045138-MU
Other Names:
R7038 (G1)
Major Collection:

Strain Information

Cd4
Name: CD4 antigen
Synonyms: Ly-4, L3T4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12504
HGNC: HGNC:1678
Homologene: 513
Utrn
Name: utrophin
Synonyms: G-utrophin, DRP, Dmdl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: X99384, paladin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27355
VEGA: 10
Homologene: 8453
Tbx21
Name: T-box 21
Synonyms: Tblym, T-bet, TBT1, Tbet
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57765
Homologene: 8353
Dst
Name: dystonin
Synonyms: A830042E19Rik, nmf339, bullous pemphigoid antigen 1, Bpag1, 2310001O04Rik, Bpag, Macf2, BPAG1, BPAG1-n, athetoid, bullous pemphigoid antigen 1, ah, nmf203
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Pds5b
Name: PDS5 cohesin associated factor B
Synonyms: Aprin, AS3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100710
Homologene: 41001
Hspa12a
Name: heat shock protein 12A
Synonyms: Gm19925, Hspa12a, 1700063D12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73442
VEGA: 19
Homologene: 18422
Aopep
Name: aminopeptidase O
Synonyms: ApO, 2010111I01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72061
HGNC: HGNC:1361
Homologene: 66273
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Htr1b
Name: 5-hydroxytryptamine (serotonin) receptor 1B
Synonyms: 5-HT1B receptor, 5-HT1B receptor, 5HT1B receptor
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15551
HGNC: HGNC:5287
Homologene: 669
Nsmce2
Name: NSE2/MMS21 homolog, SMC5-SMC6 complex SUMO ligase
Synonyms: 1110014D18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68501
VEGA: 15
Homologene: 12271
Abl2
Name: ABL proto-oncogene 2, non-receptor tyrosine kinase
Synonyms: Arg, Abll
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11352
HGNC: HGNC:77
Homologene: 5278
Hcn4
Name: hyperpolarization-activated, cyclic nucleotide-gated K+ 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330953
VEGA: 9
Homologene: 3997
Cilk1
Name: ciliogenesis associated kinase 1
Synonyms: 2210420N10Rik, Ick
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56542
Homologene: 69218
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: 1110037D04Rik, Carmil, Lrrc16, Lrrc16a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68732
Homologene: 9757
Aplf
Name: aprataxin and PNKP like factor
Synonyms: 2010301N04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72103
Homologene: 49753
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: G431004K08Rik, GCN1L, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Ltn1
Name: listerin E3 ubiquitin protein ligase 1
Synonyms: Listerin, Rnf160, Zfp294, 4930528H02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78913
VEGA: 16
Homologene: 32272
Tnks
Name: tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms: D130072O21Rik, 4930554K12Rik, mTNKS1, TANK1, tankyrase 1, Parp5a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21951
Homologene: 18405
Tubgcp5
Name: tubulin, gamma complex component 5
Synonyms: B130010C12Rik, GCP5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233276
Homologene: 14172
Med15
Name: mediator complex subunit 15
Synonyms: Pcqap, A230074L19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94112
VEGA: 16
Tex2
Name: testis expressed gene 2
Synonyms: Def-5, Taz4, 4930568E07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21763
Homologene: 32414
Sdad1
Name: SDA1 domain containing 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231452
Homologene: 6036
Zfp407
Name: zinc finger protein 407
Synonyms: 6430585N13Rik, LOC240469, LOC381139
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240476
Homologene: 86402
Sf3a3
Name: splicing factor 3a, subunit 3
Synonyms: 4930512K19Rik, 60kDa
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75062
Homologene: 4949
Zfp292
Name: zinc finger protein 292
Synonyms: 9430062L07Rik, Zfp-15, Krox-10, Zn-15, Zfp15, Zn-16, 5730450D02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 30046
Homologene: 8493
Als2
Name: alsin Rho guanine nucleotide exchange factor
Synonyms: Alsin, 9430073A21Rik, 3222402C23Rik, Als2cr6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74018
HGNC: HGNC:443
Homologene: 23264
Prpf8
Name: pre-mRNA processing factor 8
Synonyms: DBF3/PRP8, Sfprp8l, D11Bwg0410e, Prp8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192159
Homologene: 4706
Crhbp
Name: corticotropin releasing hormone binding protein
Synonyms: CRH-BP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12919
VEGA: 13
HGNC: HGNC:2356
Homologene: 1418
Ddx47
Name: DEAD box helicase 47
Synonyms: 4930588A18Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67755
Homologene: 6092
Mrps5
Name: mitochondrial ribosomal protein S5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77721
Homologene: 32726
Gins1
Name: GINS complex subunit 1
Synonyms: Psf1, 2810418N01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69270
Homologene: 44516
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, E430018P19Rik, KMT2H, 8030453L17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Pikfyve
Name: phosphoinositide kinase, FYVE type zinc finger containing
Synonyms: PipkIII, Pip5k3, 5230400C17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18711
Homologene: 32115
Dnttip2
Name: deoxynucleotidyltransferase, terminal, interacting protein 2
Synonyms: 4930588M11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99480
Homologene: 124162
Unc5a
Name: unc-5 netrin receptor A
Synonyms: Unc5h1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107448
Homologene: 41474
Syt14
Name: synaptotagmin XIV
Synonyms: B230320I09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329324
Homologene: 17719
Fndc3b
Name: fibronectin type III domain containing 3B
Synonyms: fad104, 1600019O04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72007
Homologene: 11244
Zfp457
Name: zinc finger protein 457
Synonyms: Rslcan-6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 431706
Homologene: 75311
Slc17a8
Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8
Synonyms: Vglut3, Vgt3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216227
Homologene: 13584
Gab2
Name: growth factor receptor bound protein 2-associated protein 2
Synonyms: p97, D130058I17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14389
Homologene: 69067
Cdcp1
Name: CUB domain containing protein 1
Synonyms: 9030022E12Rik, E030027H19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109332
Homologene: 11276
Muc16
Name: mucin 16
Synonyms: 1110008I14Rik, Gm21044, LOC385009
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Igf2r
Name: insulin-like growth factor 2 receptor
Synonyms: IGF-II/CI-MPR, CI-MPR, mannose-6-phosphate receptor, cation independent, M6P/IGF2R, Mpr300, CD222
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16004
HGNC: HGNC:5467
Homologene: 676
Mknk1
Name: MAP kinase-interacting serine/threonine kinase 1
Synonyms: 2410048M24Rik, Mnk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17346
HGNC: HGNC:7110
Homologene: 37838
Kif13a
Name: kinesin family member 13A
Synonyms: N-3 kinesin, 4930505I07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16553
VEGA: 13
Homologene: 22589
Eipr1
Name: EARP complex and GARP complex interacting protein 1
Synonyms: Tssc1, D12Ertd604e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380752
VEGA: 12
Homologene: 2481
Cops8
Name: COP9 signalosome subunit 8
Synonyms: Sgn8, Csn8, 9430009J09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108679
Homologene: 4882
Zfp398
Name: zinc finger protein 398
Synonyms: 5730513I23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 272347
Homologene: 12358
Tpcn1
Name: two pore channel 1
Synonyms: 5730403B01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 252972
Homologene: 9905
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Bpifb1
Name: BPI fold containing family B, member 1
Synonyms: von Ebner minor salivary protein, LPlunc1, U46068
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228801
Homologene: 50047
Baiap3
Name: BAI1-associated protein 3
Synonyms: LOC381076
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 545192
HGNC: HGNC:948
Homologene: 20844
Eif4e
Name: eukaryotic translation initiation factor 4E
Synonyms: If4e, eIF-4E
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13684
HGNC: HGNC:3287
Homologene: 123817
Gdf5
Name: growth differentiation factor 5
Synonyms: cartilage-derived morphogenetic protein-1, brp, CDMP-1, bp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14563
HGNC: HGNC:4220
Homologene: 468
Fastkd2
Name: FAST kinase domains 2
Synonyms: 2810421I24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75619
Homologene: 8957
Liph
Name: lipase, member H
Synonyms: mPA-PLA1, PLA1B, Lpdlr, LPDLR, C130037N08Rik, D16Wsu119e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239759
VEGA: 16
Homologene: 71802
Vmn2r100
Name: vomeronasal 2, receptor 100
Synonyms: EG627537
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627537
Homologene: 129750
D130043K22Rik
Name: RIKEN cDNA D130043K22 gene
Synonyms: Kiaa0319
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210108
Homologene: 8878
Tmem62
Name: transmembrane protein 62
Synonyms: B830009D23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 96957
Homologene: 11801
Capn1
Name: calpain 1
Synonyms: mu-calpin, Capa-1, Capa1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12333
VEGA: 19
HGNC: HGNC:1476
Homologene: 3800
Cgn
Name: cingulin
Synonyms: 6330408J11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70737
Homologene: 41394
Unc5d
Name: unc-5 netrin receptor D
Synonyms: D930029E11Rik, Unc5h4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 210801
Homologene: 15450
Myo3b
Name: myosin IIIB
Synonyms: A430065P19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329421
Homologene: 51393
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Gm7455, Col6a5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 665033
Homologene: 122792
Spag17
Name: sperm associated antigen 17
Synonyms: PF6, 4931427F14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74362
Homologene: 52601
Cyp2j6
Name: cytochrome P450, family 2, subfamily j, polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13110
HGNC: HGNC:2634
Homologene: 68091
Sgsm3
Name: small G protein signaling modulator 3
Synonyms: 1810012I01Rik, Rutbc3, CIP85
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105835
Homologene: 9249
Plch2
Name: phospholipase C, eta 2
Synonyms: A930027K05Rik, PLCeta2, Plcl4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269615
Homologene: 85172
Plxnb1
Name: plexin B1
Synonyms: 2900002G15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235611
HGNC: HGNC:9103
Homologene: 130508
Slc14a2
Name: solute carrier family 14 (urea transporter), member 2
Synonyms: UT-A5, UT-A3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 27411
VEGA: 18
Homologene: 5183
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213452
Homologene: 19711
Nsd3
Name: nuclear receptor binding SET domain protein 3
Synonyms: Whsc1l1, WHISTLE
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234135
Homologene: 56960
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: 2310015L07Rik, TPRBK
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209683
Homologene: 41023
Zfp467
Name: zinc finger protein 467
Synonyms: 1190001I08Rik, EZI, MNCb-3350
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68910
Homologene: 10758
Pcdhb7
Name: protocadherin beta 7
Synonyms: Pcdhb4B, PcdhbG
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93878
HGNC: HGNC:8689
Homologene: 87123
Ms4a20
Name: membrane-spanning 4-domains, subfamily A, member 20
Synonyms: 1700017D01Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69369
Alppl2
Name: alkaline phosphatase, placental-like 2
Synonyms: D1Ertd816e, Akp5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11650
Homologene: 129600
Plag1
Name: pleiomorphic adenoma gene 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56711
HGNC: HGNC:9045
Homologene: 1993
Mrc2
Name: mannose receptor, C type 2
Synonyms: uPARAP, Endo180, novel lectin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17534
Homologene: 4408
Slc41a1
Name: solute carrier family 41, member 1
Synonyms: B230315F01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98396
Homologene: 14871
Or4s2b
Name: olfactory receptor family 4 subfamily S member 2B
Synonyms: MOR226-1, GA_x6K02T2Q125-50154044-50154826, GA_x6K02T2Q125-50158288-50158818, Olfr1193, Olfr1194-ps1, MOR230-9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329460
Homologene: 27297
Hsp90b1
Name: heat shock protein 90, beta (Grp94), member 1
Synonyms: tumor rejection antigen (gp96) 1, gp96, Targ2, Tra1, endoplasmin, Tra-1, GRP94, ERp99, 90 kDa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22027
Homologene: 2476
Ntan1
Name: N-terminal Asn amidase
Synonyms: asparagine-specific N-terminal amidase
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 18203
Homologene: 7869
Spata2
Name: spermatogenesis associated 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 263876
Homologene: 4407
Cyp2c29
Name: cytochrome P450, family 2, subfamily c, polypeptide 29
Synonyms: Ahh-1, AHOHase, Ah-2, Cyp2c, AHOH, P450-2C
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13095
Homologene: 117948
Smyd4
Name: SET and MYND domain containing 4
Synonyms: G430029E23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319822
Homologene: 35098
Gata5
Name: GATA binding protein 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14464
Homologene: 32031
Rasgrf2
Name: RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms: 6330417G04Rik, Grf2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19418
HGNC: HGNC:9876
Homologene: 2169
Ptpn18
Name: protein tyrosine phosphatase, non-receptor type 18
Synonyms: PTP-K1, Ptpk1, HSCF, FLP1, PTP-HSCF
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19253
HGNC: HGNC:9649
Homologene: 74971
Mpi
Name: mannose phosphate isomerase
Synonyms: 1110002E17Rik, Mpi-1, Mpi1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110119
HGNC: HGNC:7216
Homologene: 1825
Tox2
Name: TOX high mobility group box family member 2
Synonyms: LOC269389, RxHMG1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269389
Homologene: 13155
Gdpd1
Name: glycerophosphodiester phosphodiesterase domain containing 1
Synonyms: 2610020H15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66569
Homologene: 7069
Cavin4
Name: caveolae associated 4
Synonyms: 2310039E09Rik, Murc, cavin 4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68016
Homologene: 12224
Or7g30
Name: olfactory receptor family 7 subfamily G member 30
Synonyms: MOR151-1, Olfr849, GA_x6K02T2PVTD-13176842-13177780
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258520
HGNC: HGNC:8466
Homologene: 74179
Hadha
Name: hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha
Synonyms: Mtpa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 97212
HGNC: HGNC:4801
Homologene: 152
Wdr55
Name: WD repeat domain 55
Synonyms: 2410080P20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67936
VEGA: 18
Homologene: 9789
Or10q12
Name: olfactory receptor family 10 subfamily Q member 12
Synonyms: GA_x6K02T2RE5P-4101369-4102328, Olfr1495, MOR266-9
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258341
Homologene: 73965
Cep295nl
Name: CEP295 N-terminal like
Synonyms: Ddc8, BC100451
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 58251
Homologene: 75164
Rassf6
Name: Ras association (RalGDS/AF-6) domain family member 6
Synonyms: 1600016B17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73246
Homologene: 37125
Or2aa1
Name: olfactory receptor family 2 subfamily AA member 1
Synonyms: MOR256-30, Olfr223, GA_x6K02T000SA-78-1037
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258421
Homologene: 73917
Sprr2b
Name: small proline-rich protein 2B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20756
Gm28360
Name: predicted gene 28360
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 34,182,798 bp
  • T to A, chromosome 1 at 34,459,825 bp
  • C to A, chromosome 1 at 59,167,514 bp
  • T to A, chromosome 1 at 63,731,873 bp
  • T to C, chromosome 1 at 65,234,361 bp
  • T to C, chromosome 1 at 87,089,111 bp
  • T to C, chromosome 1 at 90,603,598 bp
  • T to C, chromosome 1 at 117,853,599 bp
  • C to A, chromosome 1 at 131,842,057 bp
  • T to C, chromosome 1 at 132,454,109 bp
  • T to C, chromosome 1 at 156,641,409 bp
  • T to A, chromosome 1 at 192,983,658 bp
  • A to T, chromosome 2 at 70,095,208 bp
  • A to T, chromosome 2 at 88,678,741 bp
  • A to G, chromosome 2 at 120,993,577 bp
  • A to G, chromosome 2 at 127,600,866 bp
  • A to G, chromosome 2 at 150,917,871 bp
  • G to T, chromosome 2 at 154,202,669 bp
  • C to A, chromosome 2 at 155,944,735 bp
  • A to G, chromosome 2 at 163,314,344 bp
  • A to T, chromosome 2 at 167,485,363 bp
  • C to A, chromosome 2 at 180,333,892 bp
  • C to T, chromosome 3 at 27,501,469 bp
  • A to T, chromosome 3 at 88,982,671 bp
  • T to A, chromosome 3 at 90,159,947 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • T to G, chromosome 3 at 94,763,085 bp
  • C to A, chromosome 3 at 99,984,609 bp
  • T to A, chromosome 3 at 122,276,532 bp
  • A to G, chromosome 3 at 138,527,182 bp
  • G to T, chromosome 4 at 3,904,676 bp
  • A to G, chromosome 4 at 34,816,357 bp
  • A to G, chromosome 4 at 48,672,479 bp
  • T to A, chromosome 4 at 96,535,471 bp
  • A to G, chromosome 4 at 115,857,110 bp
  • T to A, chromosome 4 at 124,728,426 bp
  • G to C, chromosome 4 at 154,990,032 bp
  • T to C, chromosome 5 at 30,120,000 bp
  • A to T, chromosome 5 at 90,609,725 bp
  • A to G, chromosome 5 at 92,298,190 bp
  • T to A, chromosome 5 at 111,266,579 bp
  • G to A, chromosome 5 at 115,611,144 bp
  • T to C, chromosome 5 at 120,585,277 bp
  • A to G, chromosome 5 at 121,299,597 bp
  • G to T, chromosome 5 at 150,800,760 bp
  • G to T, chromosome 6 at 47,866,309 bp
  • T to C, chromosome 6 at 48,438,138 bp
  • C to T, chromosome 6 at 87,653,823 bp
  • C to T, chromosome 6 at 124,870,254 bp
  • T to A, chromosome 6 at 135,023,373 bp
  • T to G, chromosome 7 at 55,805,366 bp
  • T to A, chromosome 7 at 97,303,083 bp
  • T to C, chromosome 8 at 25,641,263 bp
  • A to G, chromosome 8 at 28,715,721 bp
  • A to T, chromosome 8 at 34,851,636 bp
  • T to A, chromosome 9 at 18,620,468 bp
  • A to C, chromosome 9 at 19,441,592 bp
  • T to C, chromosome 9 at 57,545,217 bp
  • A to T, chromosome 9 at 58,823,584 bp
  • C to T, chromosome 9 at 78,109,202 bp
  • T to A, chromosome 9 at 81,632,243 bp
  • A to G, chromosome 9 at 105,945,738 bp
  • T to A, chromosome 9 at 109,100,385 bp
  • T to C, chromosome 9 at 123,173,597 bp
  • T to C, chromosome 10 at 12,682,338 bp
  • T to C, chromosome 10 at 61,339,299 bp
  • A to T, chromosome 10 at 86,695,866 bp
  • T to C, chromosome 10 at 89,600,221 bp
  • T to C, chromosome 11 at 59,589,582 bp
  • C to A, chromosome 11 at 75,390,514 bp
  • T to A, chromosome 11 at 75,496,158 bp
  • A to G, chromosome 11 at 87,035,292 bp
  • A to G, chromosome 11 at 97,099,771 bp
  • A to G, chromosome 11 at 105,332,236 bp
  • A to T, chromosome 11 at 106,511,900 bp
  • A to G, chromosome 11 at 118,332,989 bp
  • C to T, chromosome 12 at 28,751,818 bp
  • A to G, chromosome 13 at 24,139,335 bp
  • A to G, chromosome 13 at 24,893,408 bp
  • C to T, chromosome 13 at 46,752,455 bp
  • A to G, chromosome 13 at 55,004,484 bp
  • G to T, chromosome 13 at 63,190,525 bp
  • G to A, chromosome 13 at 67,293,933 bp
  • G to A, chromosome 13 at 91,982,833 bp
  • A to G, chromosome 13 at 95,444,191 bp
  • T to A, chromosome 15 at 59,496,830 bp
  • T to C, chromosome 15 at 81,008,375 bp
  • T to C, chromosome 16 at 13,826,910 bp
  • C to T, chromosome 16 at 17,652,727 bp
  • A to T, chromosome 16 at 21,976,259 bp
  • T to C, chromosome 16 at 87,424,871 bp
  • T to C, chromosome 17 at 12,698,325 bp
  • T to A, chromosome 17 at 19,505,001 bp
  • G to A, chromosome 17 at 25,243,840 bp
  • T to G, chromosome 18 at 36,760,420 bp
  • A to T, chromosome 18 at 37,342,204 bp
  • A to T, chromosome 18 at 78,159,037 bp
  • A to G, chromosome 18 at 84,561,857 bp
  • A to T, chromosome 19 at 6,014,319 bp
  • A to T, chromosome 19 at 11,110,311 bp
  • A to T, chromosome 19 at 13,768,351 bp
  • G to A, chromosome 19 at 39,287,127 bp
  • A to G, chromosome 19 at 58,804,700 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7038 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045138-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.