Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7053Btlr/Mmmh
Stock Number:
045150-MU
Citation ID:
RRID:MMRRC_045150-MU
Other Names:
R7053 (G1)
Major Collection:

Strain Information

Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: 410I21.SP6, D16Jhu34
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110948
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: separase, SSE, ESP1, PRCE, PRCE, Cerp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105988
VEGA: 15
Homologene: 32151
Aldh1l1
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: 1810048F20Rik, Fthfd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107747
HGNC: HGNC:3978
Homologene: 122031
Mfn1
Name: mitofusin 1
Synonyms: 6330416C07Rik, 2310002F04Rik, D3Ertd265e, HR2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67414
Homologene: 11481
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Taok3
Name: TAO kinase 3
Synonyms: A430105I05Rik, 2900006A08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330177
Homologene: 83279
Pop1
Name: processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)
Synonyms: 4932434G09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67724
Homologene: 41000
Mdc1
Name: mediator of DNA damage checkpoint 1
Synonyms: NFBD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240087
Homologene: 67092
Xpo7
Name: exportin 7
Synonyms: Ranbp16, 4930506C02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 65246
VEGA: 14
Homologene: 22857
Rffl
Name: ring finger and FYVE like domain containing protein
Synonyms: 4930516L10Rik, fring, rififylin, 1700051E09Rik, Carp-2, Carp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67338
Homologene: 12116
Uhrf2
Name: ubiquitin-like, containing PHD and RING finger domains 2
Synonyms: 2310065A22Rik, Nirf, D130071B19Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 109113
Homologene: 17001
Prdm15
Name: PR domain containing 15
Synonyms: Zfp298, E130018M06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114604
Homologene: 56941
Fhip1b
Name: FHF complex subunit HOOK interacting protein 1B
Synonyms: 4632419K20Rik, 6530415H11Rik, Fam160a2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74349
Homologene: 75329
Gsdma3
Name: gasdermin A3
Synonyms: Rco2, Bsk, Fgn, Dfl, Rim3, Gsdm1l, Gsdm3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 450219
Rhou
Name: ras homolog family member U
Synonyms: 2310026M05Rik, CDC42L1, WRCH-1, mG28K, WRCH1, Arhu
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69581
Homologene: 49663
Csnk2b
Name: casein kinase 2, beta polypeptide
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13001
HGNC: HGNC:2460
Homologene: 55572
Dennd1a
Name: DENN domain containing 1A
Synonyms: 6030446I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227801
Homologene: 17141
Brip1
Name: BRCA1 interacting protein C-terminal helicase 1
Synonyms: 8030460J03Rik, BACH1, 3110009N10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237911
Homologene: 32766
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, A2mr, b2b1554Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Col27a1
Name: collagen, type XXVII, alpha 1
Synonyms: 5730512J02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 373864
Homologene: 69400
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, D9Ertd414e, 1500037O19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208898
Homologene: 45443
Vmn2r61
Name: vomeronasal 2, receptor 61
Synonyms: Casr-rs2, EG637873, Gprc2a-rs2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637873
Homologene: 129683
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210876
Homologene: 86604
Corin
Name: corin, serine peptidase
Synonyms: Lrp4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53419
Homologene: 4804
Mgat4b
Name: mannoside acetylglucosaminyltransferase 4, isoenzyme B
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103534
HGNC: HGNC:7048
Homologene: 8611
Rp1l1
Name: retinitis pigmentosa 1 homolog like 1
Synonyms: Dcdc4, Rp1hl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 271209
VEGA: 14
Homologene: 105870
Mpo
Name: myeloperoxidase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17523
HGNC: HGNC:7218
Homologene: 55450
Dnai2
Name: dynein axonemal intermediate chain 2
Synonyms: C030015H18Rik, Dnaic2, b2b3405Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432611
Homologene: 11311
Mdga2
Name: MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms: Mdga2, 9330209L04Rik, 6720489L24Rik, Mamdc1, Adp
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320772
Homologene: 45659
Ccdc13
Name: coiled-coil domain containing 13
Synonyms: 2900041A11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100502861
Homologene: 87213
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76645
Homologene: 124481
Atp6v0a2
Name: ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms: TJ6s, Tj6, ATP6a2, Atp6n2, 8430408C20Rik, V-ATPase a2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21871
Homologene: 56523
Tnrc18
Name: trinucleotide repeat containing 18
Synonyms: EG381742, Zfp469
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231861
Homologene: 45603
Grid2
Name: glutamate receptor, ionotropic, delta 2
Synonyms: GluRdelta2, tpr, B230104L07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14804
HGNC: HGNC:4576
Homologene: 74399
Mvp
Name: major vault protein
Synonyms: VAULT1, LRP, 2310009M24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78388
HGNC: HGNC:7531
Homologene: 3752
Cyp2d26
Name: cytochrome P450, family 2, subfamily d, polypeptide 26
Synonyms: 1300006E06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76279
VEGA: 15
Homologene: 130660
Oasl2
Name: 2'-5' oligoadenylate synthetase-like 2
Synonyms: M1204, Mmu-OASL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23962
Homologene: 128369
Adam26a
Name: ADAM metallopeptidase domain 26A
Synonyms: Dtgn4, Adam26
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13525
Homologene: 128363
Zfp948
Name: zinc finger protein 948
Synonyms: BC049807
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381066
VEGA: 17
Mgat4d
Name: MGAT4 family, member C
Synonyms: 4933434I20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67555
Homologene: 128538
Ccn6
Name: cellular communication network factor 6
Synonyms: LOC327743, CCN6, Wisp3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 327743
VEGA: 10
Homologene: 77038
Dkkl1
Name: dickkopf-like 1
Synonyms: mSgy, Soggy, SGY-1, SGY1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50722
Homologene: 56674
Tmem269
Name: transmembrane protein 269
Synonyms: 4930538K18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75180
Homologene: 28290
Slc30a2
Name: solute carrier family 30 (zinc transporter), member 2
Synonyms: Znt2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230810
Homologene: 40855
Or5m11b
Name: olfactory receptor family 5 subfamily M member 11B
Synonyms: GA_x6K02T2Q125-47454152-47455126, MOR198-1P, Olfr1029
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258154
Homologene: 73972
Tmem18
Name: transmembrane protein 18
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211986
VEGA: 12
Homologene: 17675
Fam174a
Name: family with sequence similarity 174, member A
Synonyms: 2310044D20Rik, Tmem157
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67698
Homologene: 12175
Serpina1b
Name: serine (or cysteine) preptidase inhibitor, clade A, member 1B
Synonyms: PI2, D12Ucla2, Spi1-2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20701
HGNC: HGNC:8941
Homologene: 20103
BC048507
Name: cDNA sequence BC048507
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408058
VEGA: 13
Homologene: 133712
Nim1k
Name: NIM1 serine/threonine protein kinase
Synonyms: E130304F04Rik, Nim1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 245269
VEGA: 13
Homologene: 25286
Ttc6
Name: tetratricopeptide repeat domain 6
Synonyms: LOC217602, EG639426, Gm9813, 4921506M07Rik, AU024163
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70846
Homologene: 78002
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 95,325,228 bp
  • A to G, chromosome 2 at 37,961,654 bp
  • G to T, chromosome 2 at 85,976,014 bp
  • A to G, chromosome 3 at 32,531,965 bp
  • T to A, chromosome 4 at 63,333,167 bp
  • T to A, chromosome 4 at 119,209,267 bp
  • G to A, chromosome 4 at 134,347,415 bp
  • T to A, chromosome 5 at 72,301,527 bp
  • A to T, chromosome 5 at 114,911,230 bp
  • T to A, chromosome 5 at 117,252,562 bp
  • A to G, chromosome 5 at 124,645,983 bp
  • A to G, chromosome 5 at 142,787,229 bp
  • T to A, chromosome 6 at 4,905,670 bp
  • G to T, chromosome 6 at 64,700,418 bp
  • C to A, chromosome 6 at 90,563,438 bp
  • A to G, chromosome 7 at 41,482,564 bp
  • A to C, chromosome 7 at 42,267,133 bp
  • G to T, chromosome 7 at 45,207,598 bp
  • C to T, chromosome 7 at 105,384,572 bp
  • T to C, chromosome 7 at 105,694,954 bp
  • T to C, chromosome 7 at 126,987,604 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • A to T, chromosome 8 at 43,568,799 bp
  • G to T, chromosome 8 at 83,371,632 bp
  • A to G, chromosome 8 at 117,013,942 bp
  • A to G, chromosome 8 at 123,654,195 bp
  • G to A, chromosome 9 at 73,932,297 bp
  • T to C, chromosome 9 at 121,833,838 bp
  • A to G, chromosome 10 at 39,158,301 bp
  • A to G, chromosome 10 at 127,541,094 bp
  • C to T, chromosome 11 at 50,233,540 bp
  • T to C, chromosome 11 at 82,812,671 bp
  • T to C, chromosome 11 at 86,192,965 bp
  • A to T, chromosome 11 at 87,803,510 bp
  • T to A, chromosome 11 at 98,629,795 bp
  • T to C, chromosome 11 at 114,738,695 bp
  • T to A, chromosome 12 at 30,584,507 bp
  • A to T, chromosome 12 at 57,660,532 bp
  • T to A, chromosome 12 at 66,689,384 bp
  • T to A, chromosome 12 at 103,732,429 bp
  • A to G, chromosome 13 at 9,610,704 bp
  • T to C, chromosome 13 at 67,863,653 bp
  • A to G, chromosome 13 at 119,727,609 bp
  • A to T, chromosome 14 at 64,031,509 bp
  • A to G, chromosome 14 at 70,684,858 bp
  • T to G, chromosome 15 at 34,530,275 bp
  • T to C, chromosome 15 at 82,792,600 bp
  • T to C, chromosome 15 at 102,316,893 bp
  • A to T, chromosome 16 at 94,268,015 bp
  • G to A, chromosome 16 at 97,794,542 bp
  • T to A, chromosome 17 at 21,584,859 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • A to G, chromosome 17 at 35,116,446 bp
  • C to T, chromosome 17 at 35,846,326 bp
  • T to A, chromosome 19 at 30,092,119 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7053 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045150-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.