Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7053Btlr/Mmmh
Stock Number:
045150-MU
Citation ID:
RRID:MMRRC_045150-MU
Other Names:
R7053 (G1)
Major Collection:

Strain Information

Hlcs
Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
Synonyms: 410I21.SP6, D16Jhu34
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110948
VEGA: 16
HGNC: HGNC:4976
Homologene: 37302
Espl1
Name: extra spindle pole bodies 1, separase
Synonyms: separase, SSE, ESP1, PRCE, PRCE, Cerp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105988
VEGA: 15
Homologene: 32151
Aldh1l1
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: 1810048F20Rik, Fthfd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107747
HGNC: HGNC:3978
Homologene: 122031
Mfn1
Name: mitofusin 1
Synonyms: 6330416C07Rik, 2310002F04Rik, D3Ertd265e, HR2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67414
Homologene: 11481
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Taok3
Name: TAO kinase 3
Synonyms: A430105I05Rik, 2900006A08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330177
Homologene: 83279
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 95,325,228 bp
  • A to G, chromosome 2 at 37,961,654 bp
  • G to T, chromosome 2 at 85,976,014 bp
  • A to G, chromosome 3 at 32,531,965 bp
  • T to A, chromosome 4 at 63,333,167 bp
  • T to A, chromosome 4 at 119,209,267 bp
  • G to A, chromosome 4 at 134,347,415 bp
  • T to A, chromosome 5 at 72,301,527 bp
  • A to T, chromosome 5 at 114,911,230 bp
  • T to A, chromosome 5 at 117,252,562 bp
  • A to G, chromosome 5 at 124,645,983 bp
  • A to G, chromosome 5 at 142,787,229 bp
  • T to A, chromosome 6 at 4,905,670 bp
  • G to T, chromosome 6 at 64,700,418 bp
  • C to A, chromosome 6 at 90,563,438 bp
  • A to G, chromosome 7 at 41,482,564 bp
  • A to C, chromosome 7 at 42,267,133 bp
  • G to T, chromosome 7 at 45,207,598 bp
  • C to T, chromosome 7 at 105,384,572 bp
  • T to C, chromosome 7 at 105,694,954 bp
  • T to C, chromosome 7 at 126,987,604 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • A to T, chromosome 8 at 43,568,799 bp
  • G to T, chromosome 8 at 83,371,632 bp
  • A to G, chromosome 8 at 117,013,942 bp
  • A to G, chromosome 8 at 123,654,195 bp
  • G to A, chromosome 9 at 73,932,297 bp
  • T to C, chromosome 9 at 121,833,838 bp
  • A to G, chromosome 10 at 39,158,301 bp
  • A to G, chromosome 10 at 127,541,094 bp
  • C to T, chromosome 11 at 50,233,540 bp
  • T to C, chromosome 11 at 82,812,671 bp
  • T to C, chromosome 11 at 86,192,965 bp
  • A to T, chromosome 11 at 87,803,510 bp
  • T to A, chromosome 11 at 98,629,795 bp
  • T to C, chromosome 11 at 114,738,695 bp
  • T to A, chromosome 12 at 30,584,507 bp
  • A to T, chromosome 12 at 57,660,532 bp
  • T to A, chromosome 12 at 66,689,384 bp
  • T to A, chromosome 12 at 103,732,429 bp
  • A to G, chromosome 13 at 9,610,704 bp
  • T to C, chromosome 13 at 67,863,653 bp
  • A to G, chromosome 13 at 119,727,609 bp
  • A to T, chromosome 14 at 64,031,509 bp
  • A to G, chromosome 14 at 70,684,858 bp
  • T to G, chromosome 15 at 34,530,275 bp
  • T to C, chromosome 15 at 82,792,600 bp
  • T to C, chromosome 15 at 102,316,893 bp
  • A to T, chromosome 16 at 94,268,015 bp
  • G to A, chromosome 16 at 97,794,542 bp
  • T to A, chromosome 17 at 21,584,859 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • A to G, chromosome 17 at 35,116,446 bp
  • C to T, chromosome 17 at 35,846,326 bp
  • T to A, chromosome 19 at 30,092,119 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7053 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045150-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.