Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7079Btlr/Mmmh
Stock Number:
045173-MU
Citation ID:
RRID:MMRRC_045173-MU
Other Names:
R7079 (G1)
Major Collection:

Strain Information

Ptk2
Name: PTK2 protein tyrosine kinase 2
Synonyms: Fadk, FAK, FRNK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14083
VEGA: 15
HGNC: HGNC:9611
Homologene: 7314
Grm1
Name: glutamate receptor, metabotropic 1
Synonyms: mGluR1, Grm1, Gprc1a, nmf373, rcw, 4930455H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14816
HGNC: HGNC:4593
Homologene: 649
Cort
Name: cortistatin
Synonyms: PCST, CST
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12854
HGNC: HGNC:2257
Homologene: 997
Gfpt2
Name: glutamine fructose-6-phosphate transaminase 2
Synonyms: GFAT2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14584
HGNC: HGNC:4242
Homologene: 68439
Trmt13
Name: tRNA methyltransferase 13
Synonyms: A930028L21Rik, 4631408H19Rik, Ccdc76
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229780
Homologene: 6875
Sacm1l
Name: SAC1 suppressor of actin mutations 1-like (yeast)
Synonyms: SAC1, Sac1p
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83493
VEGA: 9
Homologene: 6320
Hectd1
Name: HECT domain E3 ubiquitin protein ligase 1
Synonyms: A630086P08Rik, opm, b2b327Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 207304
VEGA: 12
Homologene: 9115
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 78,497,915 bp
  • T to A, chromosome 1 at 138,852,127 bp
  • T to C, chromosome 1 at 192,553,046 bp
  • A to G, chromosome 2 at 26,949,347 bp
  • C to A, chromosome 2 at 37,202,173 bp
  • C to A, chromosome 2 at 88,559,509 bp
  • T to G, chromosome 2 at 151,473,278 bp
  • T to A, chromosome 3 at 29,153,582 bp
  • T to C, chromosome 3 at 116,582,831 bp
  • G to C, chromosome 3 at 154,593,789 bp
  • T to C, chromosome 4 at 42,851,718 bp
  • C to G, chromosome 4 at 149,127,391 bp
  • A to G, chromosome 5 at 9,399,253 bp
  • T to C, chromosome 5 at 103,501,886 bp
  • C to T, chromosome 5 at 138,126,466 bp
  • A to G, chromosome 6 at 23,323,409 bp
  • T to C, chromosome 7 at 79,749,292 bp
  • C to T, chromosome 7 at 103,329,184 bp
  • A to T, chromosome 7 at 104,141,371 bp
  • A to G, chromosome 7 at 118,490,869 bp
  • G to A, chromosome 8 at 47,847,545 bp
  • T to C, chromosome 9 at 57,681,878 bp
  • T to A, chromosome 9 at 108,857,948 bp
  • A to G, chromosome 9 at 109,145,510 bp
  • T to A, chromosome 9 at 123,569,997 bp
  • T to C, chromosome 10 at 11,079,958 bp
  • T to A, chromosome 10 at 30,834,386 bp
  • A to G, chromosome 10 at 74,317,125 bp
  • A to G, chromosome 10 at 99,018,733 bp
  • G to A, chromosome 10 at 109,767,292 bp
  • A to G, chromosome 11 at 48,945,616 bp
  • G to A, chromosome 11 at 49,837,751 bp
  • A to G, chromosome 11 at 69,880,021 bp
  • T to A, chromosome 11 at 90,267,499 bp
  • G to A, chromosome 12 at 51,787,855 bp
  • G to A, chromosome 12 at 101,757,408 bp
  • A to G, chromosome 13 at 49,566,555 bp
  • T to C, chromosome 13 at 77,254,204 bp
  • A to T, chromosome 13 at 104,187,293 bp
  • C to G, chromosome 14 at 122,490,730 bp
  • G to A, chromosome 15 at 73,221,809 bp
  • G to A, chromosome 15 at 98,095,082 bp
  • T to C, chromosome 16 at 33,067,291 bp
  • CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG to CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG, chromosome 16 at 91,656,841 bp
  • T to C, chromosome 17 at 24,498,884 bp
  • T to C, chromosome 17 at 67,632,021 bp
  • C to T, chromosome 18 at 24,003,300 bp
  • G to A, chromosome 18 at 34,347,123 bp
  • T to G, chromosome 19 at 30,082,790 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7079 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045173-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.