Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7087Btlr/Mmmh
Stock Number:
045181-MU
Citation ID:
RRID:MMRRC_045181-MU
Other Names:
R7087 (G1)
Major Collection:

Strain Information

Nes
Name: nestin
Synonyms: RC2, Marc2, ESTM46, Ifaprc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Wnk1
Name: WNK lysine deficient protein kinase 1
Synonyms: 6430573H23Rik, Prkwnk1, EG406236, Hsn2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232341
Homologene: 14253
Prmt1
Name: protein arginine N-methyltransferase 1
Synonyms: 6720434D09Rik, Hrmt1l2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15469
HGNC: HGNC:5187
Homologene: 21477
Ccdc18
Name: coiled-coil domain containing 18
Synonyms: 1700021E15Rik, 4932411G06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73254
Homologene: 35455
Ddx39b
Name: DEAD box helicase 39b
Synonyms: Bat-1, Bat1, D17H6S81E-1, 0610030D10Rik, Bat1a, DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 53817
Homologene: 48376
Nfrkb
Name: nuclear factor related to kappa B binding protein
Synonyms: A530090G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235134
HGNC: HGNC:7802
Homologene: 4492
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 34,811,686 bp
  • T to C, chromosome 1 at 46,835,720 bp
  • A to T, chromosome 1 at 68,740,491 bp
  • T to C, chromosome 1 at 80,592,826 bp
  • A to T, chromosome 1 at 172,246,702 bp
  • A to T, chromosome 1 at 174,174,510 bp
  • T to C, chromosome 2 at 88,642,853 bp
  • T to C, chromosome 2 at 144,272,181 bp
  • T to C, chromosome 2 at 164,289,797 bp
  • G to T, chromosome 3 at 87,979,758 bp
  • A to G, chromosome 3 at 89,089,492 bp
  • A to C, chromosome 3 at 95,010,213 bp
  • T to A, chromosome 4 at 86,991,219 bp
  • C to T, chromosome 4 at 120,704,399 bp
  • C to T, chromosome 4 at 126,098,159 bp
  • T to C, chromosome 4 at 126,272,681 bp
  • G to T, chromosome 4 at 129,592,311 bp
  • C to A, chromosome 4 at 141,422,555 bp
  • T to A, chromosome 5 at 108,196,122 bp
  • C to T, chromosome 6 at 39,175,381 bp
  • G to A, chromosome 6 at 52,191,291 bp
  • C to T, chromosome 6 at 120,037,530 bp
  • G to A, chromosome 7 at 3,897,219 bp
  • A to T, chromosome 7 at 8,378,367 bp
  • A to G, chromosome 7 at 19,469,657 bp
  • T to C, chromosome 7 at 44,981,583 bp
  • T to A, chromosome 7 at 119,450,232 bp
  • T to A, chromosome 7 at 119,774,647 bp
  • GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
  • A to G, chromosome 8 at 13,221,856 bp
  • T to A, chromosome 8 at 58,912,354 bp
  • C to T, chromosome 9 at 31,419,932 bp
  • T to A, chromosome 10 at 5,542,024 bp
  • A to G, chromosome 10 at 80,136,408 bp
  • A to C, chromosome 11 at 30,998,321 bp
  • C to T, chromosome 11 at 33,124,677 bp
  • A to G, chromosome 11 at 50,815,213 bp
  • C to T, chromosome 12 at 4,215,307 bp
  • A to G, chromosome 13 at 93,090,975 bp
  • A to T, chromosome 15 at 84,791,832 bp
  • A to T, chromosome 15 at 103,425,449 bp
  • C to T, chromosome 17 at 35,253,049 bp
  • T to C, chromosome 18 at 43,363,530 bp
  • T to A, chromosome 18 at 54,899,397 bp
  • A to C, chromosome 18 at 77,254,542 bp
  • A to G, chromosome 19 at 6,232,550 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7087 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045181-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.