Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7087Btlr/Mmmh
Stock Number:
045181-MU
Citation ID:
RRID:MMRRC_045181-MU
Other Names:
R7087 (G1)
Major Collection:

Strain Information

Nes
Name: nestin
Synonyms: RC2, Marc2, ESTM46, Ifaprc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Wnk1
Name: WNK lysine deficient protein kinase 1
Synonyms: 6430573H23Rik, Prkwnk1, EG406236, Hsn2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232341
Homologene: 14253
Prmt1
Name: protein arginine N-methyltransferase 1
Synonyms: 6720434D09Rik, Hrmt1l2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15469
HGNC: HGNC:5187
Homologene: 21477
Ccdc18
Name: coiled-coil domain containing 18
Synonyms: 1700021E15Rik, 4932411G06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73254
Homologene: 35455
Ddx39b
Name: DEAD box helicase 39b
Synonyms: Bat-1, Bat1, D17H6S81E-1, 0610030D10Rik, Bat1a, DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 53817
Homologene: 48376
Nfrkb
Name: nuclear factor related to kappa B binding protein
Synonyms: A530090G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235134
HGNC: HGNC:7802
Homologene: 4492
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Trappc3
Name: trafficking protein particle complex 3
Synonyms: 1110058K12Rik, Bet3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27096
Homologene: 6399
St8sia5
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Synonyms: ST8SiaV, Siat8e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225742
Homologene: 8331
Mgme1
Name: mitochondrial genome maintenance exonuclease 1
Synonyms: 8430406I07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74528
Homologene: 12573
Phf21b
Name: PHD finger protein 21B
Synonyms: A730032D07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 271305
Homologene: 78154
Ppp2r5b
Name: protein phosphatase 2, regulatory subunit B', beta
Synonyms: B'beta
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225849
HGNC: HGNC:9310
Homologene: 38157
Gp2
Name: glycoprotein 2 zymogen granule membrane
Synonyms: 2310037I18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67133
HGNC: HGNC:4441
Homologene: 133790
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Dpysl3
Name: dihydropyrimidinase-like 3
Synonyms: Ulip1, Ulip, CRMP-4, TUC4, 9430041P20Rik, CRMP4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 22240
HGNC: HGNC:3015
Homologene: 20361
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20739
Homologene: 74460
Zfp608
Name: zinc finger protein 608
Synonyms: 4932417D18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269023
VEGA: 18
Homologene: 18485
Dock10
Name: dedicator of cytokinesis 10
Synonyms: Jr5, Jr4, ZIZ3, 9330153B10Rik, A630054M16Rik, Zizimin3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210293
Homologene: 45952
Slc24a2
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 2
Synonyms: 6330417K15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76376
Homologene: 10669
Kdm7a
Name: lysine (K)-specific demethylase 7A
Synonyms: A630082K20Rik, ENSMUSG00000073143, Kdm7a, Jhdm1d
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 338523
Homologene: 25281
Hspb7
Name: heat shock protein family, member 7 (cardiovascular)
Synonyms: cvHsp, Hsp25-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 29818
HGNC: HGNC:5249
Homologene: 8480
Kcnq4
Name: potassium voltage-gated channel, subfamily Q, member 4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 60613
HGNC: HGNC:6298
Homologene: 78107
Atp1a4
Name: ATPase, Na+/K+ transporting, alpha 4 polypeptide
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27222
Homologene: 113769
Arhgef4
Name: Rho guanine nucleotide exchange factor 4
Synonyms: 9330140K16Rik, Asef, C230030N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226970
HGNC: HGNC:684
Homologene: 49414
Slc39a10
Name: solute carrier family 39 (zinc transporter), member 10
Synonyms: 2900042E17Rik, Zip10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227059
Homologene: 34076
Zfp687
Name: zinc finger protein 687
Synonyms: 4931408L03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78266
Homologene: 10827
Adprhl1
Name: ADP-ribosylhydrolase like 1
Synonyms: Arh2, D330008N11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234072
Homologene: 16311
Cenpo
Name: centromere protein O
Synonyms: D12Ertd482e, 8430427C03Rik, 2810429O05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52504
Homologene: 49760
Rusc1
Name: RUN and SH3 domain containing 1
Synonyms: 2210403N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72296
Homologene: 75028
Acsm3
Name: acyl-CoA synthetase medium-chain family member 3
Synonyms: Sa, Sah
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20216
Homologene: 74559
Svs3a
Name: seminal vesicle secretory protein 3A
Synonyms: Svp-3, 9530026M05Rik, Svp3, SVS III, Svs3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64335
Homologene: 110771
Gtsf1
Name: gametocyte specific factor 1
Synonyms: Cue110, 1700006H03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74174
Homologene: 16942
Zfp354c
Name: zinc finger protein 354C
Synonyms: Kid3, AJ18, 5330421P20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 30944
Homologene: 56606
Asb3
Name: ankyrin repeat and SOCS box-containing 3
Synonyms: 2400011J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 65257
Homologene: 9391
Eif3i
Name: eukaryotic translation initiation factor 3, subunit I
Synonyms: D4Ertd632e, 36kDa, Eif3s2, TRIP-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54709
HGNC: HGNC:3272
Homologene: 2786
Pira12
Name: paired-Ig-like receptor A12
Synonyms: Gm14548
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100038909
Homologene: 134028
Cbarp
Name: calcium channel, voltage-dependent, beta subunit associated regulatory protein
Synonyms: R29144/1, Dos
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100503659
Homologene: 82309
Exoc3l2
Name: exocyst complex component 3-like 2
Synonyms: 4933417E01Rik, Gm19857
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74463
Homologene: 16328
Vmn2r44
Name: vomeronasal 2, receptor 44
Synonyms: EG434113
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434113
Homologene: 113703
Lsm10
Name: U7 snRNP-specific Sm-like protein LSM10
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 116748
Homologene: 13154
Fgf18
Name: fibroblast growth factor 18
Synonyms: FGF-18, D130055P09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14172
HGNC: HGNC:3674
Homologene: 2867
Hoxa4
Name: homeobox A4
Synonyms: Hox-1.4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15401
HGNC: HGNC:5105
Homologene: 37583
Or4s2
Name: olfactory receptor family 4 subfamily S member 2
Synonyms: GA_x6K02T2PRF0-44595-45531, GA_x6K02T2Q125-50121628-50122030, MOR230-9, Olfr526-ps1, Olfr1191
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404399
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 34,811,686 bp
  • T to C, chromosome 1 at 46,835,720 bp
  • A to T, chromosome 1 at 68,740,491 bp
  • T to C, chromosome 1 at 80,592,826 bp
  • A to T, chromosome 1 at 172,246,702 bp
  • A to T, chromosome 1 at 174,174,510 bp
  • T to C, chromosome 2 at 88,642,853 bp
  • T to C, chromosome 2 at 144,272,181 bp
  • T to C, chromosome 2 at 164,289,797 bp
  • G to T, chromosome 3 at 87,979,758 bp
  • A to G, chromosome 3 at 89,089,492 bp
  • A to C, chromosome 3 at 95,010,213 bp
  • T to A, chromosome 4 at 86,991,219 bp
  • C to T, chromosome 4 at 120,704,399 bp
  • C to T, chromosome 4 at 126,098,159 bp
  • T to C, chromosome 4 at 126,272,681 bp
  • G to T, chromosome 4 at 129,592,311 bp
  • C to A, chromosome 4 at 141,422,555 bp
  • T to A, chromosome 5 at 108,196,122 bp
  • C to T, chromosome 6 at 39,175,381 bp
  • G to A, chromosome 6 at 52,191,291 bp
  • C to T, chromosome 6 at 120,037,530 bp
  • G to A, chromosome 7 at 3,897,219 bp
  • A to T, chromosome 7 at 8,378,367 bp
  • A to G, chromosome 7 at 19,469,657 bp
  • T to C, chromosome 7 at 44,981,583 bp
  • T to A, chromosome 7 at 119,450,232 bp
  • T to A, chromosome 7 at 119,774,647 bp
  • GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
  • A to G, chromosome 8 at 13,221,856 bp
  • T to A, chromosome 8 at 58,912,354 bp
  • C to T, chromosome 9 at 31,419,932 bp
  • T to A, chromosome 10 at 5,542,024 bp
  • A to G, chromosome 10 at 80,136,408 bp
  • A to C, chromosome 11 at 30,998,321 bp
  • C to T, chromosome 11 at 33,124,677 bp
  • A to G, chromosome 11 at 50,815,213 bp
  • C to T, chromosome 12 at 4,215,307 bp
  • A to G, chromosome 13 at 93,090,975 bp
  • A to T, chromosome 15 at 84,791,832 bp
  • A to T, chromosome 15 at 103,425,449 bp
  • C to T, chromosome 17 at 35,253,049 bp
  • T to C, chromosome 18 at 43,363,530 bp
  • T to A, chromosome 18 at 54,899,397 bp
  • A to C, chromosome 18 at 77,254,542 bp
  • A to G, chromosome 19 at 6,232,550 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7087 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045181-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.