Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7105Btlr/Mmmh
Stock Number:
045197-MU
Citation ID:
RRID:MMRRC_045197-MU
Other Names:
R7105 (G1)
Major Collection:

Strain Information

Nfat5
Name: nuclear factor of activated T cells 5
Synonyms: nfatz, TonEBP, B130038B15Rik, OREBP
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54446
HGNC: HGNC:7774
Homologene: 4811
Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Vcp
Name: valosin containing protein
Synonyms: CDC48, p97, p97/VCP, AAA ATPase p97
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269523
Homologene: 5168
Blm
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12144
HGNC: HGNC:1058
Homologene: 47902
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Chtf8
Name: CTF8, chromosome transmission fidelity factor 8
Synonyms: 5830457O10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 214987
Homologene: 84588
Osbpl1a
Name: oxysterol binding protein-like 1A
Synonyms: LOC328902, G430090F17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 64291
Homologene: 84746
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 52,151,249 bp
  • A to T, chromosome 1 at 135,984,218 bp
  • T to C, chromosome 2 at 76,730,266 bp
  • G to T, chromosome 2 at 85,823,880 bp
  • A to G, chromosome 2 at 122,289,552 bp
  • A to G, chromosome 4 at 42,985,991 bp
  • A to G, chromosome 4 at 43,498,913 bp
  • G to A, chromosome 4 at 88,630,102 bp
  • T to A, chromosome 4 at 111,566,723 bp
  • T to C, chromosome 4 at 111,898,695 bp
  • T to C, chromosome 4 at 128,774,526 bp
  • T to C, chromosome 4 at 143,810,771 bp
  • T to C, chromosome 4 at 149,546,480 bp
  • T to C, chromosome 4 at 154,980,167 bp
  • T to G, chromosome 5 at 115,433,870 bp
  • T to C, chromosome 5 at 116,082,998 bp
  • A to G, chromosome 5 at 143,707,272 bp
  • A to T, chromosome 6 at 18,318,972 bp
  • TCCCC to TCCC, chromosome 6 at 30,958,541 bp
  • T to C, chromosome 6 at 40,897,766 bp
  • T to C, chromosome 6 at 95,595,654 bp
  • C to T, chromosome 6 at 108,665,036 bp
  • A to G, chromosome 6 at 125,378,805 bp
  • T to A, chromosome 7 at 5,220,500 bp
  • A to T, chromosome 7 at 23,835,323 bp
  • A to G, chromosome 7 at 36,769,756 bp
  • T to C, chromosome 7 at 80,499,768 bp
  • T to C, chromosome 7 at 139,990,055 bp
  • G to A, chromosome 7 at 141,427,652 bp
  • T to C, chromosome 8 at 79,975,009 bp
  • A to G, chromosome 8 at 106,885,251 bp
  • T to C, chromosome 8 at 107,369,191 bp
  • A to G, chromosome 8 at 122,482,118 bp
  • A to G, chromosome 8 at 124,003,212 bp
  • A to C, chromosome 9 at 7,819,441 bp
  • T to C, chromosome 9 at 58,197,814 bp
  • A to G, chromosome 9 at 66,752,406 bp
  • A to G, chromosome 9 at 110,548,260 bp
  • T to C, chromosome 10 at 4,103,261 bp
  • T to A, chromosome 10 at 45,126,063 bp
  • T to A, chromosome 11 at 9,397,842 bp
  • A to G, chromosome 11 at 61,342,443 bp
  • T to C, chromosome 12 at 3,648,391 bp
  • T to G, chromosome 12 at 11,458,277 bp
  • G to A, chromosome 13 at 100,070,181 bp
  • T to C, chromosome 14 at 4,252,479 bp
  • TTGCCATAAGTGCTAAATGAAGCC to T, chromosome 14 at 50,810,064 bp
  • A to G, chromosome 14 at 60,753,870 bp
  • G to C, chromosome 14 at 79,212,962 bp
  • G to T, chromosome 15 at 31,305,068 bp
  • T to C, chromosome 15 at 38,008,775 bp
  • C to A, chromosome 15 at 75,974,746 bp
  • T to C, chromosome 15 at 76,297,687 bp
  • T to A, chromosome 15 at 78,386,118 bp
  • C to T, chromosome 15 at 80,509,209 bp
  • G to A, chromosome 15 at 89,131,158 bp
  • A to T, chromosome 16 at 72,742,161 bp
  • A to T, chromosome 17 at 23,558,204 bp
  • G to A, chromosome 17 at 34,730,911 bp
  • T to A, chromosome 17 at 53,973,889 bp
  • T to A, chromosome 18 at 12,766,963 bp
  • C to T, chromosome 18 at 44,834,563 bp
  • T to A, chromosome 18 at 59,176,419 bp
  • A to T, chromosome 18 at 60,843,296 bp
  • A to C, chromosome 18 at 80,128,151 bp
  • T to A, chromosome 19 at 56,477,215 bp
  • T to C, chromosome 19 at 61,225,020 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7105 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045197-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.