Strain Name:
C57BL/6J-MtgxR7105Btlr/Mmmh
Stock Number:
045197-MU
Citation ID:
RRID:MMRRC_045197-MU
Other Names:
R7105 (G1)
Major Collection:

Strain Information

Nfat5
Name: nuclear factor of activated T cells 5
Synonyms: TonEBP, B130038B15Rik, OREBP, nfatz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54446
HGNC: HGNC:7774
Homologene: 4811
Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Vcp
Name: valosin containing protein
Synonyms: p97, p97/VCP, CDC48, AAA ATPase p97
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269523
Homologene: 5168
Blm
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12144
HGNC: HGNC:1058
Homologene: 47902
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd, Edd1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Chtf8
Name: CTF8, chromosome transmission fidelity factor 8
Synonyms: 5830457O10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 214987
Homologene: 84588
Osbpl1a
Name: oxysterol binding protein-like 1A
Synonyms: LOC328902, G430090F17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 64291
Homologene: 84746
Birc2
Name: baculoviral IAP repeat-containing 2
Synonyms: IAP1, MIAP1, cIAP-1, mcIAP1, MIHB, HIAP1, Api1, cIAP1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11797
HGNC: HGNC:590
Homologene: 900
Dtnb
Name: dystrobrevin, beta
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13528
HGNC: HGNC:3058
Homologene: 74875
Mthfd1l
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Synonyms: 2410004L15Rik, Fthfsdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270685
Homologene: 56706
Prep
Name: prolyl endopeptidase
Synonyms: Pop, prolyl oligopeptidase, D10Wsu136e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19072
VEGA: 10
HGNC: HGNC:9358
Homologene: 2042
Suclg2
Name: succinate-Coenzyme A ligase, GDP-forming, beta subunit
Synonyms: D6Wsu120e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20917
Homologene: 2854
Setd2
Name: SET domain containing 2
Synonyms: KMT3A, 4921524K10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235626
Homologene: 56493
Stat1
Name: signal transducer and activator of transcription 1
Synonyms: 2010005J02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20846
Homologene: 21428
Tcof1
Name: treacle ribosome biogenesis factor 1
Synonyms: treacle
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21453
Homologene: 68049
Bdp1
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: TFIIIB150, TFIIIB90, Tfnr, G630013P12Rik, B130055N23Rik, TAF3B1, TFC5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544971
Homologene: 34582
Adam8
Name: a disintegrin and metallopeptidase domain 8
Synonyms: MS2, CD156, CD156a, E430039A18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11501
HGNC: HGNC:215
Homologene: 74384
Cftr
Name: cystic fibrosis transmembrane conductance regulator
Synonyms: Abcc7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12638
HGNC: HGNC:1884
Homologene: 55465
Islr2
Name: immunoglobulin superfamily containing leucine-rich repeat 2
Synonyms: B930052A04Rik, mbu-3, Linx
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320563
VEGA: 9
Homologene: 10833
Robo1
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19876
Homologene: 2206
Car12
Name: carbonic anhydrase 12
Synonyms: 2310047E01Rik, CA XII
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76459
HGNC: HGNC:1371
Homologene: 20327
Adnp2
Name: ADNP homeobox 2
Synonyms: 8430420L05Rik, Zfp508
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240442
Homologene: 8945
Prss58
Name: serine protease 58
Synonyms: BC048599
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232717
Homologene: 65285
Hhip
Name: Hedgehog-interacting protein
Synonyms: Hhip1, Hip1, Hip
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15245
Homologene: 32469
Ythdc2
Name: YTH domain containing 2
Synonyms: 3010002F02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240255
Homologene: 11265
Piezo1
Name: piezo-type mechanosensitive ion channel component 1
Synonyms: Fam38a, Piezo1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234839
Homologene: 124356
Bhlhe40
Name: basic helix-loop-helix family, member e40
Synonyms: eip1 (E47 interaction protein 1), Sharp2, DEC1, Bhlhb2, Clast5, CR8, cytokine response gene 8, Stra13, Stra14, C130042M06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20893
HGNC: HGNC:1046
Homologene: 2722
Ctnnbip1
Name: catenin beta interacting protein 1
Synonyms: 1110008O09Rik, ICAT, Catnbip1, 2310001I19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67087
Homologene: 10641
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Ttn
Name: titin
Synonyms: connectin, 1100001C23Rik, D330041I19Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, 2310057K23Rik, shru, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Chsy3
Name: chondroitin sulfate synthase 3
Synonyms: 4833446K15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 78923
VEGA: 18
Homologene: 28624
Taf5l
Name: TATA-box binding protein associated factor 5 like
Synonyms: 1110005N04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102162
Homologene: 8676
Plekhs1
Name: pleckstrin homology domain containing, family S member 1
Synonyms: 9930023K05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226245
VEGA: 19
Homologene: 11770
Oplah
Name: 5-oxoprolinase (ATP-hydrolysing)
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75475
HGNC: HGNC:8149
Homologene: 90938
Ankrd33b
Name: ankyrin repeat domain 33B
Synonyms: 3021401C12Rik, 0610012A05Rik, 5730557B15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67434
Homologene: 12362
Slc47a2
Name: solute carrier family 47, member 2
Synonyms: 4933429E10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380701
Homologene: 134426
Duox2
Name: dual oxidase 2
Synonyms: A430065P05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214593
Homologene: 9689
Tshz3
Name: teashirt zinc finger family member 3
Synonyms: Tsh3, A630038G13Rik, teashirt3, Zfp537
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243931
Homologene: 10835
Csf2ra
Name: colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Synonyms: CD116, GM-CSF-Ra, Csfgmra, GM-CSFRalpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12982
VEGA: 19
HGNC: HGNC:2435
Homologene: 48406
C4b
Name: complement C4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12268
Homologene: 36030
Mapk12
Name: mitogen-activated protein kinase 12
Synonyms: Sapk3, Erk6, P38gamma, Prkm12
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 29857
VEGA: 15
HGNC: HGNC:6874
Homologene: 55705
Parp2
Name: poly (ADP-ribose) polymerase family, member 2
Synonyms: PARP-2, Adprtl2, Adprt2, C78626, Aspartl2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11546
VEGA: 14
HGNC: HGNC:272
Homologene: 4004
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Rad51ap2
Name: RAD51 associated protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 209550
VEGA: 12
Homologene: 85245
Enthd1
Name: ENTH domain containing 1
Synonyms: LOC383075
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 383075
VEGA: 15
Homologene: 45131
Vmn1r176
Name: vomeronasal 1 receptor 176
Synonyms: Gm5998
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546943
Homologene: 128341
Cimip4
Name: ciliary microtubule inner protein 4
Synonyms: 1700061J05Rik, Tex33
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73376
VEGA: 15
Homologene: 18682
Pramel26
Name: PRAME like 26
Synonyms: Gm13084
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381569
Homologene: 77858
Agbl4
Name: ATP/GTP binding protein-like 4
Synonyms: Ccp6, 4930578N11Rik, 4931433A01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 78933
Homologene: 84880
Spata13
Name: spermatogenesis associated 13
Synonyms: ESTM11
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219140
Homologene: 19482
Slc5a9
Name: solute carrier family 5 (sodium/glucose cotransporter), member 9
Synonyms: SGLT4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230612
Homologene: 17081
Cend1
Name: cell cycle exit and neuronal differentiation 1
Synonyms: BM88, 1500001H12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57754
Homologene: 137316
Plekhg6
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 6
Synonyms: LOC213522
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213522
Homologene: 32395
Cyth3
Name: cytohesin 3
Synonyms: Pscd3, cytohesin 3, Grp1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19159
HGNC: HGNC:9504
Homologene: 3116
Arhgef39
Name: Rho guanine nucleotide exchange factor 39
Synonyms: E130306D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230098
Homologene: 19225
Msi1
Name: musashi RNA-binding protein 1
Synonyms: Msi1h, m-Msi-1, Msi1, Musahi1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17690
HGNC: HGNC:7330
Homologene: 55657
Zfp707
Name: zinc finger protein 707
Synonyms: 1500031N24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69020
Homologene: 18364
Sult1c1
Name: sulfotransferase family, cytosolic, 1C, member 1
Synonyms: Stp2, Sult1a2, (PST)G, mOLFST, P-SULT
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20888
Homologene: 56817
Zfp957
Name: zinc finger protein 957
Synonyms: AU017455
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105590
Tmem233
Name: transmembrane protein 233
Synonyms: Gm13843
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545798
Homologene: 54444
Zfp362
Name: zinc finger protein 362
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230761
Homologene: 77409
Vmn1r57
Name: vomeronasal 1 receptor 57
Synonyms: Gm7519
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665150
Homologene: 41799
Zfp213
Name: zinc finger protein 213
Synonyms: D17Ertd197e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 449521
VEGA: 17
Homologene: 55809
Klf14
Name: Kruppel-like transcription factor 14
Synonyms: BTEB5, 5330411L03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 619665
Homologene: 76469
Or2ah1
Name: olfactory receptor family 2 subfamily AH member 1
Synonyms: GA_x6K02T2Q125-47301584-47302519, MOR260-5, Olfr1018
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258579
Homologene: 27216
Gm3138
Name: predicted gene 3138
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100041100
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 52,151,249 bp
  • A to T, chromosome 1 at 135,984,218 bp
  • T to C, chromosome 2 at 76,730,266 bp
  • G to T, chromosome 2 at 85,823,880 bp
  • A to G, chromosome 2 at 122,289,552 bp
  • A to G, chromosome 4 at 42,985,991 bp
  • A to G, chromosome 4 at 43,498,913 bp
  • G to A, chromosome 4 at 88,630,102 bp
  • T to A, chromosome 4 at 111,566,723 bp
  • T to C, chromosome 4 at 111,898,695 bp
  • T to C, chromosome 4 at 128,774,526 bp
  • T to C, chromosome 4 at 143,810,771 bp
  • T to C, chromosome 4 at 149,546,480 bp
  • T to C, chromosome 4 at 154,980,167 bp
  • T to G, chromosome 5 at 115,433,870 bp
  • T to C, chromosome 5 at 116,082,998 bp
  • A to G, chromosome 5 at 143,707,272 bp
  • A to T, chromosome 6 at 18,318,972 bp
  • TCCCC to TCCC, chromosome 6 at 30,958,541 bp
  • T to C, chromosome 6 at 40,897,766 bp
  • T to C, chromosome 6 at 95,595,654 bp
  • C to T, chromosome 6 at 108,665,036 bp
  • A to G, chromosome 6 at 125,378,805 bp
  • T to A, chromosome 7 at 5,220,500 bp
  • A to T, chromosome 7 at 23,835,323 bp
  • A to G, chromosome 7 at 36,769,756 bp
  • T to C, chromosome 7 at 80,499,768 bp
  • T to C, chromosome 7 at 139,990,055 bp
  • G to A, chromosome 7 at 141,427,652 bp
  • T to C, chromosome 8 at 79,975,009 bp
  • A to G, chromosome 8 at 106,885,251 bp
  • T to C, chromosome 8 at 107,369,191 bp
  • A to G, chromosome 8 at 122,482,118 bp
  • A to G, chromosome 8 at 124,003,212 bp
  • A to C, chromosome 9 at 7,819,441 bp
  • T to C, chromosome 9 at 58,197,814 bp
  • A to G, chromosome 9 at 66,752,406 bp
  • A to G, chromosome 9 at 110,548,260 bp
  • T to C, chromosome 10 at 4,103,261 bp
  • T to A, chromosome 10 at 45,126,063 bp
  • T to A, chromosome 11 at 9,397,842 bp
  • A to G, chromosome 11 at 61,342,443 bp
  • T to C, chromosome 12 at 3,648,391 bp
  • T to G, chromosome 12 at 11,458,277 bp
  • G to A, chromosome 13 at 100,070,181 bp
  • T to C, chromosome 14 at 4,252,479 bp
  • TTGCCATAAGTGCTAAATGAAGCC to T, chromosome 14 at 50,810,064 bp
  • A to G, chromosome 14 at 60,753,870 bp
  • G to C, chromosome 14 at 79,212,962 bp
  • G to T, chromosome 15 at 31,305,068 bp
  • T to C, chromosome 15 at 38,008,775 bp
  • C to A, chromosome 15 at 75,974,746 bp
  • T to C, chromosome 15 at 76,297,687 bp
  • T to A, chromosome 15 at 78,386,118 bp
  • C to T, chromosome 15 at 80,509,209 bp
  • G to A, chromosome 15 at 89,131,158 bp
  • A to T, chromosome 16 at 72,742,161 bp
  • A to T, chromosome 17 at 23,558,204 bp
  • G to A, chromosome 17 at 34,730,911 bp
  • T to A, chromosome 17 at 53,973,889 bp
  • T to A, chromosome 18 at 12,766,963 bp
  • C to T, chromosome 18 at 44,834,563 bp
  • T to A, chromosome 18 at 59,176,419 bp
  • A to T, chromosome 18 at 60,843,296 bp
  • A to C, chromosome 18 at 80,128,151 bp
  • T to A, chromosome 19 at 56,477,215 bp
  • T to C, chromosome 19 at 61,225,020 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7105 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045197-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.