Strain Name:
C57BL/6J-MtgxR7110Btlr/Mmmh
Stock Number:
045202-MU
Citation ID:
RRID:MMRRC_045202-MU
Other Names:
R7110 (G1)
Major Collection:

Strain Information

Polr3e
Name: polymerase (RNA) III (DNA directed) polypeptide E
Synonyms: Sin, RPC5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26939
Homologene: 14052
Cdh1
Name: cadherin 1
Synonyms: UM, L-CAM, E-cad, E-cadherin, Ecad, uvomorulin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12550
HGNC: HGNC:1748
Homologene: 20917
Sgca
Name: sarcoglycan, alpha (dystrophin-associated glycoprotein)
Synonyms: 50DAG, Asg, adhalin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20391
Homologene: 9
Pdzd2
Name: PDZ domain containing 2
Synonyms: 4930537L06Rik, A930022H17Rik, Pdzk3, LOC223364, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Mgmt
Name: O-6-methylguanine-DNA methyltransferase
Synonyms: Agat, AGT
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17314
HGNC: HGNC:7059
Homologene: 31089
Agrn
Name: agrin
Synonyms: nmf380, Agrin, NMF380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: 9530001P15Rik, Ponsin, 2310065E01Rik, Sh3d5, c-Cbl-associated protein, CAP
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Cog7
Name: component of oligomeric golgi complex 7
Synonyms: 5630400E24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233824
Homologene: 33431
Stxbp3
Name: syntaxin binding protein 3
Synonyms: Stxbp3, Stxbp3a, Munc-18c
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20912
Homologene: 5260
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Mtg1
Name: mitochondrial ribosome-associated GTPase 1
Synonyms: LOC212508, Gtpbp7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212508
Homologene: 44527
Phox2b
Name: paired-like homeobox 2b
Synonyms: Dilp1, GENA 269, NBPhox, Px2b, Pmx2b, Phox2b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18935
HGNC: HGNC:9143
Homologene: 68371
Gfral
Name: GDNF family receptor alpha like
Synonyms: GRAL
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 404194
Homologene: 45748
Ccdc25
Name: coiled-coil domain containing 25
Synonyms: 2610528H13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67179
VEGA: 14
Homologene: 6645
Dcaf6
Name: DDB1 and CUL4 associated factor 6
Synonyms: 1200006M05Rik, NRIP, PC326, Iqwd1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74106
Homologene: 10199
Tecpr2
Name: tectonin beta-propeller repeat containing 2
Synonyms: 4930573I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104859
VEGA: 12
Homologene: 8897
Ppp4r2
Name: protein phosphatase 4, regulatory subunit 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232314
Homologene: 17953
Spink7
Name: serine peptidase inhibitor, Kazal type 7 (putative)
Synonyms: EG408198
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 408198
VEGA: 18
Homologene: 57174
Pdgfra
Name: platelet derived growth factor receptor, alpha polypeptide
Synonyms: Pdgfr-2, CD140a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18595
HGNC: HGNC:8803
Homologene: 31361
Slurp2
Name: secreted Ly6/Plaur domain containing 2
Synonyms: 2300005B03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69462
Homologene: 104043
Vat1
Name: vesicle amine transport 1
Synonyms: VAT-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 26949
Homologene: 36200
Frmd4b
Name: FERM domain containing 4B
Synonyms: GRSP1, 6030440G05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232288
Homologene: 14916
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: 1700034M11Rik, hyrh, 4930545D19Rik, hy-3, hy3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Tns2
Name: tensin 2
Synonyms: Tenc1, nph, nep
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 209039
VEGA: 15
Homologene: 37077
Med12l
Name: mediator complex subunit 12-like
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329650
Homologene: 43143
Abca4
Name: ATP-binding cassette, sub-family A member 4
Synonyms: D430003I15Rik, Rim protein, RmP, Abc10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11304
HGNC: HGNC:34
Homologene: 298
Ccdc73
Name: coiled-coil domain containing 73
Synonyms: 2210415I11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 211936
Homologene: 52235
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: flamingo, mfmi1, Adgrc2, EGFL2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Cdh5
Name: cadherin 5
Synonyms: VEcad, VE-Cad, CD144, 7B4/cadherin-5, VECD, VEC, VE-cadherin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12562
HGNC: HGNC:1764
Homologene: 1359
Usp40
Name: ubiquitin specific peptidase 40
Synonyms: B230215L03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227334
Homologene: 32400
Adamts7
Name: ADAM metallopeptidase with thrombospondin type 1 motif 7
Synonyms: ADAM-TS7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108153
HGNC: HGNC:223
Homologene: 22803
Ly75
Name: lymphocyte antigen 75
Synonyms: CD205, DEC-205
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17076
Homologene: 31085
1810065E05Rik
Name: RIKEN cDNA 1810065E05 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69864
Homologene: 87042
Tulp4
Name: TUB like protein 4
Synonyms: 1110057P05Rik, 2210038L17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68842
Homologene: 32467
Chd5
Name: chromodomain helicase DNA binding protein 5
Synonyms: B230399N07Rik, 4930532L22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269610
Homologene: 56712
Tbc1d9b
Name: TBC1 domain family, member 9B
Synonyms: 2700008N14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76795
Homologene: 28106
Proc
Name: protein C
Synonyms: PC, inactivator of coagulation factors Va, VIII
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19123
VEGA: 18
HGNC: HGNC:9451
Homologene: 37288
Adgrg3
Name: adhesion G protein-coupled receptor G3
Synonyms: Pb99, A030001G24Rik, Gpr97
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54672
Homologene: 18129
Cacna2d1
Name: calcium channel, voltage-dependent, alpha2/delta subunit 1
Synonyms: Cacna2, Ca(v)alpha2delta1, Cchl2a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12293
HGNC: HGNC:1399
Homologene: 579
Myot
Name: myotilin
Synonyms: Ttid, 5530402I04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 58916
Homologene: 4942
Fscn2
Name: fascin actin-bundling protein 2
Synonyms: C630046B20Rik, ahl8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 238021
HGNC: HGNC:3960
Homologene: 22722
Vmn2r28
Name: vomeronasal 2, receptor 28
Synonyms: EG665255
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665255
Homologene: 129605
Muc21
Name: mucin 21
Synonyms: Gm9573, epiglycanin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Pcdhb3
Name: protocadherin beta 3
Synonyms: PcdhbC
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93874
HGNC: HGNC:8688
Homologene: 115665
Nlrp4f
Name: NLR family, pyrin domain containing 4F
Synonyms: Nalp-kappa, C330026N02Rik, Nalp4f
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 97895
VEGA: 13
Homologene: 87252
Habp2
Name: hyaluronic acid binding protein 2
Synonyms: FSAP
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226243
HGNC: HGNC:4798
Homologene: 3050
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Mgat5
Name: mannoside acetylglucosaminyltransferase 5
Synonyms: beta1,6N-acetylglucosaminyltransferase V, GlcNAc-TV, 5330407H02Rik, 4930471A21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107895
HGNC: HGNC:7049
Homologene: 1808
Donson
Name: downstream neighbor of SON
Synonyms: 1110025J21Rik, ORF60, Donson
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 60364
HGNC: HGNC:2993
Homologene: 32350
Hoxc10
Name: homeobox C10
Synonyms: Hox-3.6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 209448
HGNC: HGNC:5122
Homologene: 9680
Slc7a10
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 10
Synonyms: D7Bwg0847e, Asc-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53896
Homologene: 56767
Jhy
Name: junctional cadherin complex regulator
Synonyms: 4931429I11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70989
Homologene: 11726
Gprin1
Name: G protein-regulated inducer of neurite outgrowth 1
Synonyms: GRIN1, Z16
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26913
Homologene: 8072
Fam53c
Name: family with sequence similarity 53, member C
Synonyms: 2810012G03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66306
VEGA: 18
HGNC: HGNC:1336
Homologene: 9586
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: Gm889, LOC380755
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Nsun5
Name: NOL1/NOP2/Sun domain family, member 5
Synonyms: 9830109N13Rik, Nol1r, Wbscr20a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100609
Homologene: 6828
Or7a42
Name: olfactory receptor family 7 subfamily A member 42
Synonyms: MOR139-5P, GA_x6K02T2QGN0-2857086-2856154, Olfr8
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18372
Homologene: 136441
Mrpl57
Name: mitochondrial ribosomal protein L57
Synonyms: Mrp63, 2610025P17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67840
VEGA: 14
Homologene: 11422
Gm21698
Name: predicted gene, 21698
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100862388
Homologene: 69402
Igkv12-89
Name: immunoglobulin kappa chain variable 12-89
Synonyms: Gm16905
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 384411
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 12,838,601 bp
  • G to T, chromosome 1 at 87,986,162 bp
  • A to G, chromosome 1 at 127,382,979 bp
  • A to T, chromosome 1 at 165,351,968 bp
  • A to G, chromosome 2 at 60,376,184 bp
  • A to G, chromosome 2 at 104,973,224 bp
  • C to A, chromosome 3 at 59,262,224 bp
  • C to A, chromosome 3 at 108,397,865 bp
  • C to A, chromosome 3 at 108,816,333 bp
  • T to A, chromosome 3 at 122,132,643 bp
  • A to G, chromosome 4 at 152,385,439 bp
  • A to G, chromosome 4 at 156,178,875 bp
  • C to A, chromosome 5 at 16,357,784 bp
  • T to C, chromosome 5 at 25,985,177 bp
  • G to A, chromosome 5 at 67,096,162 bp
  • T to A, chromosome 5 at 75,189,234 bp
  • T to A, chromosome 5 at 135,371,250 bp
  • T to C, chromosome 6 at 68,835,131 bp
  • A to G, chromosome 6 at 70,960,746 bp
  • A to T, chromosome 6 at 97,296,231 bp
  • T to A, chromosome 6 at 100,865,862 bp
  • T to G, chromosome 7 at 5,490,734 bp
  • A to G, chromosome 7 at 35,199,584 bp
  • T to A, chromosome 7 at 120,940,287 bp
  • T to C, chromosome 7 at 121,935,776 bp
  • G to T, chromosome 7 at 137,085,986 bp
  • G to A, chromosome 7 at 140,146,866 bp
  • T to G, chromosome 7 at 141,799,822 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • T to C, chromosome 8 at 95,034,963 bp
  • A to G, chromosome 8 at 104,140,768 bp
  • G to A, chromosome 8 at 106,668,544 bp
  • A to T, chromosome 8 at 110,354,951 bp
  • T to C, chromosome 9 at 40,917,260 bp
  • A to G, chromosome 9 at 76,164,830 bp
  • A to G, chromosome 9 at 90,193,964 bp
  • T to A, chromosome 9 at 110,450,765 bp
  • A to T, chromosome 10 at 78,955,450 bp
  • A to T, chromosome 11 at 50,163,830 bp
  • A to G, chromosome 11 at 58,425,745 bp
  • T to A, chromosome 11 at 94,963,401 bp
  • G to T, chromosome 11 at 101,465,713 bp
  • A to T, chromosome 11 at 120,366,754 bp
  • A to T, chromosome 12 at 40,185,273 bp
  • T to G, chromosome 12 at 110,918,972 bp
  • T to C, chromosome 13 at 54,739,243 bp
  • T to A, chromosome 13 at 65,199,346 bp
  • G to A, chromosome 14 at 57,826,297 bp
  • A to G, chromosome 14 at 65,856,716 bp
  • A to T, chromosome 15 at 12,368,013 bp
  • G to A, chromosome 15 at 74,743,115 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • G to C, chromosome 15 at 102,105,366 bp
  • A to T, chromosome 15 at 102,970,921 bp
  • A to G, chromosome 16 at 91,656,518 bp
  • G to A, chromosome 16 at 91,682,121 bp
  • C to T, chromosome 17 at 6,231,780 bp
  • CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT to CGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT, chromosome 17 at 35,622,618 bp
  • A to T, chromosome 18 at 32,133,388 bp
  • T to A, chromosome 18 at 34,762,470 bp
  • A to G, chromosome 18 at 37,302,922 bp
  • A to G, chromosome 18 at 44,341,386 bp
  • T to C, chromosome 18 at 62,594,267 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • A to T, chromosome 19 at 56,311,164 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7110 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045202-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.