Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7110Btlr/Mmmh
Stock Number:
045202-MU
Citation ID:
RRID:MMRRC_045202-MU
Other Names:
R7110 (G1)
Major Collection:

Strain Information

Polr3e
Name: polymerase (RNA) III (DNA directed) polypeptide E
Synonyms: RPC5, Sin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26939
Homologene: 14052
Cdh1
Name: cadherin 1
Synonyms: E-cadherin, Ecad, UM, uvomorulin, L-CAM, E-cad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12550
HGNC: HGNC:1748
Homologene: 20917
Sgca
Name: sarcoglycan, alpha (dystrophin-associated glycoprotein)
Synonyms: adhalin, 50DAG, Asg
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20391
Homologene: 9
Pdzd2
Name: PDZ domain containing 2
Synonyms: 4930537L06Rik, LOC223364, A930022H17Rik, Pdzk3, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Mgmt
Name: O-6-methylguanine-DNA methyltransferase
Synonyms: AGT, Agat
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17314
HGNC: HGNC:7059
Homologene: 31089
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 12,838,601 bp
  • G to T, chromosome 1 at 87,986,162 bp
  • A to G, chromosome 1 at 127,382,979 bp
  • A to T, chromosome 1 at 165,351,968 bp
  • A to G, chromosome 2 at 60,376,184 bp
  • A to G, chromosome 2 at 104,973,224 bp
  • C to A, chromosome 3 at 59,262,224 bp
  • C to A, chromosome 3 at 108,397,865 bp
  • C to A, chromosome 3 at 108,816,333 bp
  • T to A, chromosome 3 at 122,132,643 bp
  • A to G, chromosome 4 at 152,385,439 bp
  • A to G, chromosome 4 at 156,178,875 bp
  • C to A, chromosome 5 at 16,357,784 bp
  • T to C, chromosome 5 at 25,985,177 bp
  • G to A, chromosome 5 at 67,096,162 bp
  • T to A, chromosome 5 at 75,189,234 bp
  • T to A, chromosome 5 at 135,371,250 bp
  • T to C, chromosome 6 at 68,835,131 bp
  • A to G, chromosome 6 at 70,960,746 bp
  • A to T, chromosome 6 at 97,296,231 bp
  • T to A, chromosome 6 at 100,865,862 bp
  • T to G, chromosome 7 at 5,490,734 bp
  • A to G, chromosome 7 at 35,199,584 bp
  • T to A, chromosome 7 at 120,940,287 bp
  • T to C, chromosome 7 at 121,935,776 bp
  • G to T, chromosome 7 at 137,085,986 bp
  • G to A, chromosome 7 at 140,146,866 bp
  • T to G, chromosome 7 at 141,799,822 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • T to C, chromosome 8 at 95,034,963 bp
  • A to G, chromosome 8 at 104,140,768 bp
  • G to A, chromosome 8 at 106,668,544 bp
  • A to T, chromosome 8 at 110,354,951 bp
  • T to C, chromosome 9 at 40,917,260 bp
  • A to G, chromosome 9 at 76,164,830 bp
  • A to G, chromosome 9 at 90,193,964 bp
  • T to A, chromosome 9 at 110,450,765 bp
  • A to T, chromosome 10 at 78,955,450 bp
  • A to T, chromosome 11 at 50,163,830 bp
  • A to G, chromosome 11 at 58,425,745 bp
  • T to A, chromosome 11 at 94,963,401 bp
  • G to T, chromosome 11 at 101,465,713 bp
  • A to T, chromosome 11 at 120,366,754 bp
  • A to T, chromosome 12 at 40,185,273 bp
  • T to G, chromosome 12 at 110,918,972 bp
  • T to C, chromosome 13 at 54,739,243 bp
  • T to A, chromosome 13 at 65,199,346 bp
  • G to A, chromosome 14 at 57,826,297 bp
  • A to G, chromosome 14 at 65,856,716 bp
  • A to T, chromosome 15 at 12,368,013 bp
  • G to A, chromosome 15 at 74,743,115 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • G to C, chromosome 15 at 102,105,366 bp
  • A to T, chromosome 15 at 102,970,921 bp
  • A to G, chromosome 16 at 91,656,518 bp
  • G to A, chromosome 16 at 91,682,121 bp
  • C to T, chromosome 17 at 6,231,780 bp
  • CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT to CGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT, chromosome 17 at 35,622,618 bp
  • A to T, chromosome 18 at 32,133,388 bp
  • T to A, chromosome 18 at 34,762,470 bp
  • A to G, chromosome 18 at 37,302,922 bp
  • A to G, chromosome 18 at 44,341,386 bp
  • T to C, chromosome 18 at 62,594,267 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • A to T, chromosome 19 at 56,311,164 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7110 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045202-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.