Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7120Btlr/Mmmh
Stock Number:
045209-MU
Citation ID:
RRID:MMRRC_045209-MU
Other Names:
R7120 (G1)
Major Collection:

Strain Information

Cadps
Name: Ca2+-dependent secretion activator
Synonyms: CAPS1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27062
VEGA: 14
HGNC: HGNC:1426
Homologene: 2755
Nae1
Name: NEDD8 activating enzyme E1 subunit 1
Synonyms: Appbp1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234664
HGNC: HGNC:621
Homologene: 68370
Syt6
Name: synaptotagmin VI
Synonyms: 3110037A08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54524
Homologene: 10301
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: alpha13.2, Cav3.2, T-type Cav3.2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
P2rx7
Name: purinergic receptor P2X, ligand-gated ion channel, 7
Synonyms: P2X7 receptor, P2X7R, P2X(7)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18439
HGNC: HGNC:8537
Homologene: 1925
Rubcn
Name: RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein
Synonyms: 1700021K19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 100502698
Homologene: 15687
Csrnp3
Name: cysteine-serine-rich nuclear protein 3
Synonyms: mbu1, A330102K23Rik, CSRNP-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77771
Homologene: 11803
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 44,126,446 bp
  • A to G, chromosome 1 at 55,079,229 bp
  • A to G, chromosome 1 at 88,200,800 bp
  • A to C, chromosome 1 at 125,403,432 bp
  • A to T, chromosome 1 at 150,700,541 bp
  • A to G, chromosome 2 at 14,308,697 bp
  • T to A, chromosome 2 at 32,051,042 bp
  • C to A, chromosome 2 at 66,023,010 bp
  • T to C, chromosome 2 at 85,072,097 bp
  • G to A, chromosome 3 at 20,011,541 bp
  • A to T, chromosome 3 at 36,481,867 bp
  • T to C, chromosome 3 at 103,587,357 bp
  • T to C, chromosome 3 at 142,543,973 bp
  • A to G, chromosome 3 at 142,606,746 bp
  • T to A, chromosome 4 at 45,040,533 bp
  • A to G, chromosome 4 at 94,582,682 bp
  • A to T, chromosome 5 at 93,183,331 bp
  • G to T, chromosome 5 at 96,752,960 bp
  • A to T, chromosome 5 at 108,808,638 bp
  • A to G, chromosome 5 at 122,681,294 bp
  • A to G, chromosome 5 at 123,029,472 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to C, chromosome 6 at 34,686,076 bp
  • A to T, chromosome 6 at 48,465,571 bp
  • T to A, chromosome 6 at 48,906,597 bp
  • T to C, chromosome 6 at 68,220,526 bp
  • A to G, chromosome 6 at 87,087,393 bp
  • T to C, chromosome 6 at 123,828,435 bp
  • G to T, chromosome 7 at 23,578,019 bp
  • T to A, chromosome 7 at 64,372,486 bp
  • T to C, chromosome 7 at 126,829,333 bp
  • T to A, chromosome 7 at 128,173,974 bp
  • A to G, chromosome 8 at 22,327,673 bp
  • A to G, chromosome 8 at 84,842,828 bp
  • C to A, chromosome 8 at 86,860,867 bp
  • A to G, chromosome 8 at 104,526,278 bp
  • T to C, chromosome 9 at 38,378,649 bp
  • T to C, chromosome 9 at 57,059,882 bp
  • T to C, chromosome 9 at 77,786,750 bp
  • G to A, chromosome 9 at 105,420,186 bp
  • G to A, chromosome 9 at 106,515,796 bp
  • T to A, chromosome 9 at 121,460,498 bp
  • C to T, chromosome 10 at 5,293,971 bp
  • C to T, chromosome 10 at 26,230,966 bp
  • T to C, chromosome 10 at 111,299,449 bp
  • T to A, chromosome 11 at 57,528,217 bp
  • A to T, chromosome 11 at 73,787,114 bp
  • C to A, chromosome 11 at 94,492,428 bp
  • C to A, chromosome 11 at 98,454,991 bp
  • T to C, chromosome 11 at 101,168,238 bp
  • C to A, chromosome 12 at 79,070,939 bp
  • C to A, chromosome 12 at 81,378,486 bp
  • A to C, chromosome 12 at 116,872,056 bp
  • C to A, chromosome 12 at 119,445,745 bp
  • A to T, chromosome 13 at 47,100,183 bp
  • A to T, chromosome 13 at 97,944,539 bp
  • T to C, chromosome 13 at 108,362,247 bp
  • T to A, chromosome 14 at 12,439,919 bp
  • A to G, chromosome 14 at 30,559,822 bp
  • C to T, chromosome 14 at 60,875,247 bp
  • G to T, chromosome 15 at 5,212,007 bp
  • A to G, chromosome 15 at 98,861,065 bp
  • A to G, chromosome 15 at 102,474,678 bp
  • C to T, chromosome 16 at 32,836,469 bp
  • CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC to CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC, chromosome 16 at 91,656,691 bp
  • T to G, chromosome 16 at 91,670,526 bp
  • G to T, chromosome 17 at 12,271,467 bp
  • T to G, chromosome 17 at 25,391,507 bp
  • A to T, chromosome 17 at 33,135,813 bp
  • T to C, chromosome 17 at 80,034,057 bp
  • G to A, chromosome 18 at 36,993,787 bp
  • A to G, chromosome 19 at 6,297,561 bp
  • G to A, chromosome 19 at 10,204,238 bp
  • C to T, chromosome 19 at 42,052,673 bp
  • T to A, chromosome 19 at 60,852,039 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7120 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045209-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.