Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7123Btlr/Mmmh
Stock Number:
045211-MU
Citation ID:
RRID:MMRRC_045211-MU
Other Names:
R7123 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Htr1d
Name: 5-hydroxytryptamine (serotonin) receptor 1D
Synonyms: Gpcr14, Htr1db
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15552
HGNC: HGNC:5289
Homologene: 20240
Orc1
Name: origin recognition complex, subunit 1
Synonyms: MmORC1, Orc1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18392
HGNC: HGNC:8487
Homologene: 31221
Tiparp
Name: TCDD-inducible poly(ADP-ribose) polymerase
Synonyms: DDF1, PARP-7, PARP7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99929
Homologene: 9167
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Barhl1
Name: BarH like homeobox 1
Synonyms: Dres115, MBH2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54422
HGNC: HGNC:953
Homologene: 81871
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Kntc1
Name: kinetochore associated 1
Synonyms: jgl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208628
Homologene: 32227
Scamp2
Name: secretory carrier membrane protein 2
Synonyms: Sc2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24044
VEGA: 9
Homologene: 4163
Ago3
Name: argonaute RISC catalytic subunit 3
Synonyms: argonaute 3, eIF2C3, C130014L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214150
Homologene: 49799
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Nfrkb
Name: nuclear factor related to kappa B binding protein
Synonyms: A530090G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235134
HGNC: HGNC:7802
Homologene: 4492
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Zbtb21
Name: zinc finger and BTB domain containing 21
Synonyms: Znf295, 5430437K12Rik, B430213I24Rik, Zfp295
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114565
VEGA: 16
Homologene: 10799
Abca17
Name: ATP-binding cassette, sub-family A member 17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381072
Homologene: 86807
Gfpt1
Name: glutamine fructose-6-phosphate transaminase 1
Synonyms: GFAT, GFA, GFAT1, 2810423A18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14583
HGNC: HGNC:4241
Homologene: 68220
Zfp451
Name: zinc finger protein 451
Synonyms: Kiaa0576-hp, 4933435G09Rik, 4930515K21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98403
Homologene: 9188
Dhtkd1
Name: dehydrogenase E1 and transketolase domain containing 1
Synonyms: C330018I04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209692
Homologene: 10278
Sv2b
Name: synaptic vesicle glycoprotein 2b
Synonyms: A830038F04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 64176
Homologene: 32236
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Akap3
Name: A kinase anchor protein 3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11642
HGNC: HGNC:373
Homologene: 4688
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Ttll7
Name: tubulin tyrosine ligase-like family, member 7
Synonyms: 1110049N09Rik, 4921517B04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70892
Homologene: 41578
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Aknad1
Name: AKNA domain containing 1
Synonyms: 4921525H12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329738
Homologene: 51892
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Wnk2
Name: WNK lysine deficient protein kinase 2
Synonyms: ESTM15, 1810073P09Rik, X83337
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75607
Homologene: 19155
Umodl1
Name: uromodulin-like 1
Synonyms: D17Ertd488e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52020
VEGA: 17
Homologene: 45466
Csf2ra
Name: colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Synonyms: CD116, Csfgmra, GM-CSF-Ra, GM-CSFRalpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12982
VEGA: 19
HGNC: HGNC:2435
Homologene: 48406
Topaz1
Name: testis and ovary specific PAZ domain containing 1
Synonyms: Gm9524
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 671232
VEGA: 9
Homologene: 19835
Synpo2
Name: synaptopodin 2
Synonyms: myopodin, Myo, 1110069I04Rik, 9530006G20Rik, 2310068J10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 118449
Homologene: 15400
Vmn2r104
Name: vomeronasal 2, receptor 104
Synonyms: V2r7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22313
Homologene: 129751
Myo5c
Name: myosin VC
Synonyms: 9130003O20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208943
VEGA: 9
HGNC: HGNC:7604
Homologene: 135711
Pus1
Name: pseudouridine synthase 1
Synonyms: MPUS1, mPus1p, A730013B20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56361
Homologene: 5931
Rgma
Name: repulsive guidance molecule family member A
Synonyms: RGM domain family, member A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244058
Homologene: 10626
Mmp8
Name: matrix metallopeptidase 8
Synonyms: Collagenase-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17394
VEGA: 9
HGNC: HGNC:7175
Homologene: 22482
Mcmdc2
Name: minichromosome maintenance domain containing 2
Synonyms: 6030422M02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240697
Homologene: 18309
Cfd
Name: complement factor D
Synonyms: D component (adipsin) of complement, DF, factor D, Adn
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11537
VEGA: 10
HGNC: HGNC:2771
Homologene: 20453
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: VKIND, very-kind, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76484
Homologene: 45138
Skint9
Name: selection and upkeep of intraepithelial T cells 9
Synonyms: A030013N09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329918
Homologene: 136292
Or14j7
Name: olfactory receptor family 14 subfamily J member 7
Synonyms: GA_x6K02T2PSCP-2374126-2375048, MOR218-13, Olfr128
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 383243
Homologene: 134080
Kti12
Name: KTI12 homolog, chromatin associated
Synonyms: 1110001A12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100087
Homologene: 6347
Cfap157
Name: cilia and flagella associated protein 157
Synonyms: 1700019L03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227736
Homologene: 53056
Spata31d1e
Name: spermatogenesis associated 31 subfamily D, member 1E
Synonyms: 1700014D04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 102638268
Homologene: 140986
Disp1
Name: dispatched RND transporter family member 1
Synonyms: DispA, 1190008H24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68897
Homologene: 14133
Dnajc22
Name: DnaJ heat shock protein family (Hsp40) member C22
Synonyms: 2810451A06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72778
Homologene: 11777
Ebna1bp2
Name: EBNA1 binding protein 2
Synonyms: p40, 1810014B19Rik, Nobp, Ebp2, B830003A16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69072
Homologene: 4969
Sars2
Name: seryl-aminoacyl-tRNA synthetase 2
Synonyms: 2410015F05Rik, D7Ertd353e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71984
Homologene: 6073
Gm5460
Name: predicted gene 5460
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 432838
VEGA: 14
Or1e20
Name: olfactory receptor family 1 subfamily E member 20
Synonyms: GA_x6K02T2P1NL-3594531-3593598, MOR135-25, Or1e20-ps1, Olfr379-ps1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 257942
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 9,940,418 bp
  • A to T, chromosome 1 at 33,776,869 bp
  • A to G, chromosome 1 at 75,489,669 bp
  • C to A, chromosome 1 at 183,087,466 bp
  • A to T, chromosome 2 at 5,917,780 bp
  • C to T, chromosome 2 at 28,909,931 bp
  • T to C, chromosome 2 at 32,779,401 bp
  • C to A, chromosome 2 at 128,613,010 bp
  • A to T, chromosome 3 at 65,553,527 bp
  • T to G, chromosome 3 at 108,775,244 bp
  • A to G, chromosome 3 at 123,113,186 bp
  • C to T, chromosome 3 at 146,913,296 bp
  • A to C, chromosome 4 at 108,588,687 bp
  • T to C, chromosome 4 at 108,848,482 bp
  • C to T, chromosome 4 at 112,390,977 bp
  • A to G, chromosome 4 at 118,625,575 bp
  • C to A, chromosome 4 at 126,355,005 bp
  • C to T, chromosome 4 at 136,442,353 bp
  • A to T, chromosome 4 at 156,172,840 bp
  • T to C, chromosome 5 at 110,773,932 bp
  • T to C, chromosome 5 at 123,781,726 bp
  • A to T, chromosome 6 at 87,056,186 bp
  • A to T, chromosome 6 at 126,866,304 bp
  • T to C, chromosome 7 at 28,753,441 bp
  • T to C, chromosome 7 at 29,046,854 bp
  • A to C, chromosome 7 at 73,409,391 bp
  • C to T, chromosome 7 at 75,117,702 bp
  • G to A, chromosome 7 at 139,936,836 bp
  • A to T, chromosome 9 at 7,563,195 bp
  • A to G, chromosome 9 at 31,414,015 bp
  • A to T, chromosome 9 at 57,587,102 bp
  • A to G, chromosome 9 at 75,289,223 bp
  • G to A, chromosome 9 at 122,748,415 bp
  • T to C, chromosome 10 at 30,654,439 bp
  • G to A, chromosome 10 at 79,892,497 bp
  • T to C, chromosome 11 at 59,013,651 bp
  • T to A, chromosome 11 at 73,433,710 bp
  • A to G, chromosome 13 at 49,081,986 bp
  • G to A, chromosome 13 at 59,743,440 bp
  • A to T, chromosome 13 at 81,592,574 bp
  • A to G, chromosome 14 at 34,042,025 bp
  • TACCTTGTTACTGAGCCCTTCTCACCTTCACAGACACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC to TACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC, chromosome 15 at 27,742,313 bp
  • A to C, chromosome 15 at 99,101,204 bp
  • T to C, chromosome 16 at 32,750,691 bp
  • C to T, chromosome 16 at 97,949,912 bp
  • T to C, chromosome 17 at 20,040,826 bp
  • A to G, chromosome 17 at 24,265,975 bp
  • T to A, chromosome 17 at 24,594,768 bp
  • T to A, chromosome 17 at 30,982,344 bp
  • A to G, chromosome 17 at 36,127,794 bp
  • T to A, chromosome 17 at 37,923,676 bp
  • A to G, chromosome 19 at 61,226,862 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7123 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045211-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.