Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7126Btlr/Mmmh
Stock Number:
045213-MU
Citation ID:
RRID:MMRRC_045213-MU
Other Names:
R7126 (G1)
Major Collection:

Strain Information

Ess2
Name: ess-2 splicing factor
Synonyms: ES2, Dgsi, D16H22S1269E, Es2el, Dgcr14
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27886
VEGA: 16
Homologene: 11184
Ireb2
Name: iron responsive element binding protein 2
Synonyms: Irp2, D9Ertd85e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64602
VEGA: 9
HGNC: HGNC:6115
Homologene: 11280
Terf1
Name: telomeric repeat binding factor 1
Synonyms: Trf1, Trbf1, Pin2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21749
Homologene: 7570
Ptpn23
Name: protein tyrosine phosphatase, non-receptor type 23
Synonyms: PTP-TD14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104831
Homologene: 135706
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Trim24
Name: tripartite motif-containing 24
Synonyms: Tif1a, D430004I05Rik, A130082H20Rik, TIF1alpha
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21848
Homologene: 20830
Top2a
Name: topoisomerase (DNA) II alpha
Synonyms: DNA Topoisomerase II alpha, Top-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21973
Homologene: 830
Dennd4c
Name: DENN domain containing 4C
Synonyms: 1700065A05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329877
Homologene: 23057
Ssb
Name: small RNA binding exonuclease protection factor La
Synonyms: La protein, SS-B, autoantigen La, Sjogren syndrome antigen B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20823
Homologene: 2366
Chlsn
Name: cholesin
Synonyms: 3110082I17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73212
Homologene: 49901
Atg13
Name: autophagy related 13
Synonyms: 1110053A20Rik, D2Ertd391e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51897
Homologene: 32229
Klhl12
Name: kelch-like 12
Synonyms: C3ip1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240756
Homologene: 23317
Trpm4
Name: transient receptor potential cation channel, subfamily M, member 4
Synonyms: TRPM4B, 1110030C19Rik, LTRPC4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68667
Homologene: 23033
Acsbg2
Name: acyl-CoA synthetase bubblegum family member 2
Synonyms: Bgr
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328845
Homologene: 57133
Btnl9
Name: butyrophilin-like 9
Synonyms: D330012D11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237754
Homologene: 68540
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Mme
Name: membrane metallo endopeptidase
Synonyms: CD10, neprilysin, 6030454K05Rik, NEP, neutral endopeptidase
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17380
HGNC: HGNC:7154
Homologene: 5275
Ubr2
Name: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224826
VEGA: 17
Homologene: 26151
Lzic
Name: leucine zipper and CTNNBIP1 domain containing
Synonyms: 1810030J04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69151
Homologene: 12301
Inpp4a
Name: inositol polyphosphate-4-phosphatase, type I
Synonyms: 107kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269180
HGNC: HGNC:6074
Homologene: 2871
Mtus1
Name: mitochondrial tumor suppressor 1
Synonyms: MD44, MTSG1, Atip1, B430305I03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102103
Homologene: 100292
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Trpa1
Name: transient receptor potential cation channel, subfamily A, member 1
Synonyms: ANKTM1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 277328
HGNC: HGNC:497
Homologene: 7189
Mthfd2
Name: methylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase
Synonyms: NMDMC
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17768
HGNC: HGNC:7434
Homologene: 21321
Baiap3
Name: BAI1-associated protein 3
Synonyms: LOC381076
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 545192
HGNC: HGNC:948
Homologene: 20844
Cox16
Name: cytochrome c oxidase assembly protein 16
Synonyms: 1810055I05Rik, 1810020G14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66272
Homologene: 9520
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1154Clo, b2b1134Clo, b2b1537Clo, b2b1565Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Smarcd1
Name: SWI/SNF related BAF chromatin remodeling complex subunit D1
Synonyms: Baf60a, D15Kz1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 83797
VEGA: 15
Homologene: 20670
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225997
VEGA: 19
Homologene: 9767
Scn7a
Name: sodium channel, voltage-gated, type VII, alpha
Synonyms: Nav2.3, NaG, Nav2, 1110034K09Rik, Scn6a, Nax
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20272
Homologene: 55706
Vmn2r57
Name: vomeronasal 2, receptor 57
Synonyms: EG269902
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269902
Homologene: 104832
Sh3rf1
Name: SH3 domain containing ring finger 1
Synonyms: Posh, 2200003J05Rik, Sh3md2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 59009
Homologene: 10988
Trim58
Name: tripartite motif-containing 58
Synonyms: LOC216781, LOC386443
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216781
Homologene: 9135
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Mroh2a
Name: maestro heat-like repeat family member 2A
Synonyms: ENSMUSG00000044873, OTTMUSG00000020804, Heatr7b1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100040766
Homologene: 85300
Wdr31
Name: WD repeat domain 31
Synonyms: 5430402I10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71354
Homologene: 11360
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Kcnj2
Name: potassium inwardly-rectifying channel, subfamily J, member 2
Synonyms: IRK1, Kir2.1, Kcnf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16518
HGNC: HGNC:6263
Homologene: 20249
Krt78
Name: keratin 78
Synonyms: 2310030B04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 332131
VEGA: 15
Homologene: 65261
Filip1
Name: filamin A interacting protein 1
Synonyms: 5730485H21Rik, FILIP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70598
Homologene: 6700
Taar7b
Name: trace amine-associated receptor 7B
Synonyms: LOC209517
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209517
Homologene: 134040
Spag17
Name: sperm associated antigen 17
Synonyms: 4931427F14Rik, PF6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74362
Homologene: 52601
Vmn1r46
Name: vomeronasal 1 receptor 46
Synonyms: V1rb8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113856
Homologene: 134021
Olfm5
Name: olfactomedin 5
Synonyms: E030002O03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244180
Homologene: 18253
Grid2
Name: glutamate receptor, ionotropic, delta 2
Synonyms: GluRdelta2, tpr, B230104L07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14804
HGNC: HGNC:4576
Homologene: 74399
Or10q1
Name: olfactory receptor family 10 subfamily Q member 1
Synonyms: GA_x6K02T2RE5P-4082427-4083374, MOR266-1, Olfr1494
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258992
Homologene: 64855
Or2ad1
Name: olfactory receptor family 2 subfamily AD member 1
Synonyms: GA_x6K02T2QHY8-12104556-12105500, MOR256-15, Olfr1368
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258527
Homologene: 105156
Cyp2d26
Name: cytochrome P450, family 2, subfamily d, polypeptide 26
Synonyms: 1300006E06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76279
VEGA: 15
Homologene: 130660
Kbtbd11
Name: kelch repeat and BTB (POZ) domain containing 11
Synonyms: 4930465M17Rik, 2900016B01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74901
Homologene: 28701
Vmn2r54
Name: vomeronasal 2, receptor 54
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 666085
Homologene: 104040
Niban1
Name: niban apoptosis regulator 1
Synonyms: Niban, Fam129a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 63913
Homologene: 62170
Rgs22
Name: regulator of G-protein signalling 22
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 626596
Homologene: 75047
Cnnm1
Name: cyclin M1
Synonyms: Acdp1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83674
VEGA: 19
HGNC: HGNC:102
Homologene: 10673
Grep1
Name: glycine rich extracellular protein 1
Synonyms: 1520401A03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320309
Cbs
Name: cystathionine beta-synthase
Synonyms: HIP4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12411
HGNC: HGNC:1550
Homologene: 37258
Plin1
Name: perilipin 1
Synonyms: 6030432J05Rik, perilipin B, perilipin A, Peri, Plin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 103968
HGNC: HGNC:9076
Homologene: 2001
Acadsb
Name: acyl-Coenzyme A dehydrogenase, short/branched chain
Synonyms: 1300003O09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66885
HGNC: HGNC:91
Homologene: 1216
Parp12
Name: poly (ADP-ribose) polymerase family, member 12
Synonyms: Zc3hdc1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243771
Homologene: 11236
Prl7a1
Name: prolactin family 7, subfamily a, member 1
Synonyms: PLP-G, PLP-E, Prlpg, Prlpe
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19113
Homologene: 136279
Or7a39
Name: olfactory receptor family 7 subfamily A member 39
Synonyms: GA_x6K02T2QGN0-2932609-2931677, MOR139-6, Olfr1355
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 257734
Homologene: 136441
B4galt2
Name: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53418
HGNC: HGNC:925
Homologene: 2804
Ankdd1b
Name: ankyrin repeat and death domain containing 1B
Synonyms: 9330128J19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 271144
Homologene: 19566
Scrt2
Name: scratch family zinc finger 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545474
Homologene: 99867
Gja10
Name: gap junction protein, alpha 10
Synonyms: Cx-57, connexin-57, Cx59, Cx57
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14610
Homologene: 7733
Btbd18
Name: BTB domain containing 18
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100270744
Homologene: 122125
Tff3
Name: trefoil factor 3, intestinal
Synonyms: mITF, ITF
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21786
Homologene: 2427
Kif19b
Name: kinesin family member 19B
Synonyms: Gm4869
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 101055939
Homologene: 82478
Gm47959
Name: predicted gene, 47959
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 14,890,424 bp
  • A to T, chromosome 1 at 15,813,139 bp
  • C to A, chromosome 1 at 37,374,272 bp
  • G to A, chromosome 1 at 83,000,782 bp
  • G to T, chromosome 1 at 88,254,935 bp
  • A to G, chromosome 1 at 134,467,783 bp
  • A to G, chromosome 1 at 139,480,803 bp
  • T to A, chromosome 1 at 151,714,567 bp
  • G to T, chromosome 2 at 66,757,286 bp
  • A to G, chromosome 2 at 69,866,501 bp
  • A to G, chromosome 2 at 82,983,141 bp
  • A to T, chromosome 2 at 84,666,202 bp
  • G to A, chromosome 2 at 91,680,420 bp
  • C to T, chromosome 2 at 152,093,086 bp
  • A to G, chromosome 3 at 19,980,624 bp
  • T to C, chromosome 3 at 36,481,839 bp
  • C to T, chromosome 3 at 63,368,901 bp
  • T to G, chromosome 3 at 100,101,435 bp
  • A to T, chromosome 4 at 32,601,014 bp
  • T to A, chromosome 4 at 62,463,429 bp
  • A to G, chromosome 4 at 86,807,430 bp
  • A to G, chromosome 4 at 117,877,538 bp
  • A to G, chromosome 4 at 149,488,675 bp
  • G to T, chromosome 5 at 139,361,250 bp
  • A to T, chromosome 5 at 140,491,318 bp
  • A to G, chromosome 6 at 37,919,457 bp
  • T to C, chromosome 6 at 39,111,736 bp
  • T to A, chromosome 6 at 64,076,810 bp
  • A to G, chromosome 6 at 83,313,490 bp
  • T to G, chromosome 6 at 89,976,994 bp
  • G to A, chromosome 6 at 146,357,796 bp
  • A to G, chromosome 7 at 12,632,161 bp
  • A to G, chromosome 7 at 41,399,794 bp
  • A to T, chromosome 7 at 45,310,709 bp
  • T to C, chromosome 7 at 79,726,664 bp
  • A to T, chromosome 7 at 104,159,980 bp
  • T to C, chromosome 7 at 131,437,448 bp
  • G to A, chromosome 8 at 15,028,759 bp
  • A to G, chromosome 8 at 41,015,402 bp
  • A to T, chromosome 8 at 61,349,424 bp
  • G to A, chromosome 8 at 91,015,225 bp
  • T to C, chromosome 9 at 18,641,216 bp
  • T to A, chromosome 9 at 54,886,567 bp
  • A to G, chromosome 9 at 79,898,295 bp
  • T to C, chromosome 9 at 110,388,744 bp
  • T to A, chromosome 10 at 24,000,062 bp
  • T to C, chromosome 10 at 78,879,577 bp
  • G to T, chromosome 11 at 49,169,255 bp
  • T to C, chromosome 11 at 58,640,579 bp
  • A to G, chromosome 11 at 99,014,992 bp
  • A to G, chromosome 11 at 111,072,822 bp
  • T to A, chromosome 12 at 81,472,166 bp
  • A to T, chromosome 13 at 21,142,718 bp
  • C to T, chromosome 13 at 27,642,419 bp
  • G to A, chromosome 13 at 93,089,940 bp
  • A to G, chromosome 13 at 96,429,862 bp
  • A to T, chromosome 15 at 28,349,837 bp
  • A to T, chromosome 15 at 36,103,808 bp
  • T to C, chromosome 15 at 82,794,008 bp
  • A to T, chromosome 15 at 99,709,325 bp
  • T to C, chromosome 15 at 101,948,436 bp
  • T to C, chromosome 16 at 17,911,290 bp
  • C to T, chromosome 17 at 23,720,564 bp
  • T to A, chromosome 17 at 25,245,145 bp
  • T to G, chromosome 17 at 31,127,436 bp
  • T to A, chromosome 17 at 31,619,139 bp
  • A to T, chromosome 17 at 46,974,056 bp
  • A to T, chromosome 17 at 56,846,633 bp
  • C to T, chromosome 19 at 9,002,359 bp
  • T to A, chromosome 19 at 13,749,523 bp
  • A to C, chromosome 19 at 16,710,879 bp
  • C to T, chromosome 19 at 18,854,033 bp
  • T to C, chromosome 19 at 43,484,853 bp
  • TCGGGGCCGGGGCCGGGGCCG to TCGGGGCCGGGGCCGGGGCCGGGGCCG, chromosome X at 101,794,171 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7126 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045213-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.