Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7126Btlr/Mmmh
Stock Number:
045213-MU
Citation ID:
RRID:MMRRC_045213-MU
Other Names:
R7126 (G1)
Major Collection:

Strain Information

Ess2
Name: ess-2 splicing factor
Synonyms: ES2, Dgsi, D16H22S1269E, Es2el, Dgcr14
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27886
VEGA: 16
Homologene: 11184
Ireb2
Name: iron responsive element binding protein 2
Synonyms: Irp2, D9Ertd85e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64602
VEGA: 9
HGNC: HGNC:6115
Homologene: 11280
Terf1
Name: telomeric repeat binding factor 1
Synonyms: Trf1, Trbf1, Pin2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21749
Homologene: 7570
Ptpn23
Name: protein tyrosine phosphatase, non-receptor type 23
Synonyms: PTP-TD14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104831
Homologene: 135706
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Trim24
Name: tripartite motif-containing 24
Synonyms: Tif1a, D430004I05Rik, A130082H20Rik, TIF1alpha
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21848
Homologene: 20830
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 14,890,424 bp
  • A to T, chromosome 1 at 15,813,139 bp
  • C to A, chromosome 1 at 37,374,272 bp
  • G to A, chromosome 1 at 83,000,782 bp
  • G to T, chromosome 1 at 88,254,935 bp
  • A to G, chromosome 1 at 134,467,783 bp
  • A to G, chromosome 1 at 139,480,803 bp
  • T to A, chromosome 1 at 151,714,567 bp
  • G to T, chromosome 2 at 66,757,286 bp
  • A to G, chromosome 2 at 69,866,501 bp
  • A to G, chromosome 2 at 82,983,141 bp
  • A to T, chromosome 2 at 84,666,202 bp
  • G to A, chromosome 2 at 91,680,420 bp
  • C to T, chromosome 2 at 152,093,086 bp
  • A to G, chromosome 3 at 19,980,624 bp
  • T to C, chromosome 3 at 36,481,839 bp
  • C to T, chromosome 3 at 63,368,901 bp
  • T to G, chromosome 3 at 100,101,435 bp
  • A to T, chromosome 4 at 32,601,014 bp
  • T to A, chromosome 4 at 62,463,429 bp
  • A to G, chromosome 4 at 86,807,430 bp
  • A to G, chromosome 4 at 117,877,538 bp
  • A to G, chromosome 4 at 149,488,675 bp
  • G to T, chromosome 5 at 139,361,250 bp
  • A to T, chromosome 5 at 140,491,318 bp
  • A to G, chromosome 6 at 37,919,457 bp
  • T to C, chromosome 6 at 39,111,736 bp
  • T to A, chromosome 6 at 64,076,810 bp
  • A to G, chromosome 6 at 83,313,490 bp
  • T to G, chromosome 6 at 89,976,994 bp
  • G to A, chromosome 6 at 146,357,796 bp
  • A to G, chromosome 7 at 12,632,161 bp
  • A to G, chromosome 7 at 41,399,794 bp
  • A to T, chromosome 7 at 45,310,709 bp
  • T to C, chromosome 7 at 79,726,664 bp
  • A to T, chromosome 7 at 104,159,980 bp
  • T to C, chromosome 7 at 131,437,448 bp
  • G to A, chromosome 8 at 15,028,759 bp
  • A to G, chromosome 8 at 41,015,402 bp
  • A to T, chromosome 8 at 61,349,424 bp
  • G to A, chromosome 8 at 91,015,225 bp
  • T to C, chromosome 9 at 18,641,216 bp
  • T to A, chromosome 9 at 54,886,567 bp
  • A to G, chromosome 9 at 79,898,295 bp
  • T to C, chromosome 9 at 110,388,744 bp
  • T to A, chromosome 10 at 24,000,062 bp
  • T to C, chromosome 10 at 78,879,577 bp
  • G to T, chromosome 11 at 49,169,255 bp
  • T to C, chromosome 11 at 58,640,579 bp
  • A to G, chromosome 11 at 99,014,992 bp
  • A to G, chromosome 11 at 111,072,822 bp
  • T to A, chromosome 12 at 81,472,166 bp
  • A to T, chromosome 13 at 21,142,718 bp
  • C to T, chromosome 13 at 27,642,419 bp
  • G to A, chromosome 13 at 93,089,940 bp
  • A to G, chromosome 13 at 96,429,862 bp
  • A to T, chromosome 15 at 28,349,837 bp
  • A to T, chromosome 15 at 36,103,808 bp
  • T to C, chromosome 15 at 82,794,008 bp
  • A to T, chromosome 15 at 99,709,325 bp
  • T to C, chromosome 15 at 101,948,436 bp
  • T to C, chromosome 16 at 17,911,290 bp
  • C to T, chromosome 17 at 23,720,564 bp
  • T to A, chromosome 17 at 25,245,145 bp
  • T to G, chromosome 17 at 31,127,436 bp
  • T to A, chromosome 17 at 31,619,139 bp
  • A to T, chromosome 17 at 46,974,056 bp
  • A to T, chromosome 17 at 56,846,633 bp
  • C to T, chromosome 19 at 9,002,359 bp
  • T to A, chromosome 19 at 13,749,523 bp
  • A to C, chromosome 19 at 16,710,879 bp
  • C to T, chromosome 19 at 18,854,033 bp
  • T to C, chromosome 19 at 43,484,853 bp
  • TCGGGGCCGGGGCCGGGGCCG to TCGGGGCCGGGGCCGGGGCCGGGGCCG, chromosome X at 101,794,171 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7126 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045213-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.