Strain Name:
Stock Number:
Citation ID:
Other Names:
R7131 (G1)
Major Collection:

Strain Information

Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
Homologene: 376
Name: corticotropin releasing hormone receptor 2
Synonyms: CRF-R2, CRF 2 receptor, CRFR2alpha, CRH-R2, CRFR2beta, Crfr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12922
Homologene: 55612
Name: neurogenin 1
Synonyms: Neurod3, neurogenin, Math4C, ngn1, bHLHa6, neurogenin 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18014
VEGA: 13
Homologene: 4490
Name: cholinergic receptor, nicotinic, alpha polypeptide 9
Synonyms: Gm8311, 2410015I05Rik, Acra9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231252
Homologene: 9729
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73998
Homologene: 57095
Name: regulatory factor X, 3 (influences HLA class II expression)
Synonyms: C230093O12Rik, MRFX3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19726
Homologene: 7917
Name: cellular communication network factor 1
Synonyms: Cyr61, CCN1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16007
Homologene: 1194
Name: zinc finger protein 207
Synonyms: Zep, 8430401D15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22680
Homologene: 134624
Name: DOT1 like histone lysine methyltransferase
Synonyms: mDot1, KMT4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 208266
Homologene: 32779
Name: kinesin family member 13B
Synonyms: C130021D12Rik, N-3 kinesin, GAKIN, 5330429L19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16554
VEGA: 14
Homologene: 9073
Name: regulatory factor X, 1 (influences HLA class II expression)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19724
Homologene: 2189
Name: Sec23 interacting protein
Synonyms: D7Ertd373e, p125
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207352
Homologene: 38288
Name: zinc finger protein 462
Synonyms: Zfpip, 9430078C22Rik, Gt4-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Name: bromodomain and WD repeat domain containing 1
Synonyms: Wdr9, 5330419I02Rik, G1-403-16, repro5, D530019K20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 93871
Homologene: 23130
Name: topoisomerase (DNA) II alpha
Synonyms: Top-2, DNA Topoisomerase II alpha
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21973
Homologene: 830
Name: KN motif and ankyrin repeat domains 2
Synonyms: Ankrd25
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235041
Homologene: 9163
Name: ubiquitin specific peptidase 24
Synonyms: 2700066K03Rik, 2810030C21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329908
Homologene: 35420
Name: NADH:ubiquinone oxidoreductase subunit B6
Synonyms: LOC230075
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230075
Homologene: 1864
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: SYNE-1, C130039F11Rik, A330049M09Rik, enaptin165, nesprin-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Name: limb region 1 like
Synonyms: 1110013E13Rik, D15Ertd735e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74775
Homologene: 10011
Name: SET domain containing 1A
Synonyms: KMT2F
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233904
Homologene: 52251
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: b2b414Clo, D330044F14Rik, 4432416O06Rik, DHC1b, D030010H02Rik, Dnchc2, m407Asp, DHC2, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
Homologene: 14468
Name: spectrin beta, non-erythrocytic 2
Synonyms: Spnb3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20743
VEGA: 19
Homologene: 48482
Name: target of myb1 trafficking protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21968
Homologene: 88453
Name: zinc finger with KRAB and SCAN domains 8
Synonyms: D430019P06Rik, Zfp192, 2510038J07Rik, LD5-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 93681
Homologene: 21268
Name: ATR interacting protein
Synonyms: 6620401K05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235610
Homologene: 15601
Name: tRNA methyltransferase 44
Synonyms: 2310079F23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78890
Homologene: 12708
Name: elongation factor like GTPase 1
Synonyms: D7Ertd791e, 4932434J20Rik, Eftud1, 6030468D11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101592
Homologene: 11599
Name: peter pan homolog
Synonyms: SSF1, A230087P06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235036
Homologene: 5690
Name: dehydrogenase E1 and transketolase domain containing 1
Synonyms: C330018I04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209692
Homologene: 10278
Name: MDS1 and EVI1 complex locus
Synonyms: MDS1-EVI1, D630039M04Rik, ZNFPR1B1, Evi-1, Evi1, Mds1, Jbo, Prdm3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14013
Homologene: 21086
Name: ADAM metallopeptidase domain 15
Synonyms: metargidin, MDC15
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11490
Homologene: 2829
Name: eukaryotic translation initiation factor 4E family member 1B
Synonyms: Eif4eloo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218268
Homologene: 100945
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Name: NLR family, pyrin domain containing 4A
Synonyms: Nalp4a, Nalp-eta, E330028A19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243880
Homologene: 79696
Name: protein tyrosine phosphatase receptor type D
Synonyms: B230219D21Rik, 3000002J10Rik, 1110002J03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19266
Name: microsomal triglyceride transfer protein
Synonyms: 1810043K16Rik, MTP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17777
Homologene: 212
Name: lysine methyltransferase 5B
Synonyms: Suv4-20h1, Suv420h1, C630029K18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225888
Homologene: 32351
Name: protein associated with topoisomerase II homolog 2 (yeast)
Synonyms: Pat1a, 4930424G05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67578
Homologene: 12155
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, Dnahc17, Dnahcl1, 2810003K23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
Homologene: 72102
Name: EvC ciliary complex subunit 2
Synonyms: Ellis van Creveld syndrome 2, Lbn, limbin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68525
Homologene: 17117
Name: dynein axonemal intermediate chain 7
Synonyms: A230084G12Rik, Casc1, Las1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320662
Homologene: 41242
Name: lon peptidase 1, mitochondrial
Synonyms: Prss15, 1200017E13Rik, LON
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74142
VEGA: 17
Homologene: 3521
Name: pyrroline-5-carboxylate reductase 3
Synonyms: 1110058B13Rik, 2700073G24Rik, Pycrl
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66194
VEGA: 15
Homologene: 56130
Name: ubiquitin specific peptidase like 1
Synonyms: E430026A01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231915
Homologene: 4235
Name: NLR family, pyrin domain containing 14
Synonyms: Nalp-iota, GC-LRR, Nalp14, 4921520L01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76858
Homologene: 18531
Name: vomeronasal 1 receptor 231
Synonyms: V1re7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171230
Name: solute carrier family 39 (zinc transporter), member 12
Synonyms: LOC277468
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277468
Homologene: 17654
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: Slo1, BK channel alpha subunit, BKCa, Slo, mSlo1, 5730414M22Rik, MaxiK
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16531
Homologene: 1693
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Synonyms: A730039N16Rik, D030049F17Rik, Nedl2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329152
Homologene: 66192
Name: olfactory receptor family 1 subfamily E member 34
Synonyms: Olfr394, MOR135-8, GA_x6K02T2P1NL-4043306-4042374
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259009
Homologene: 133669
Name: 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270198
Homologene: 48288
Name: folate hydrolase 1
Synonyms: glutamate carboxypeptidase II, GCP2, prostate-specific membrane antigen, mopsm
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53320
Homologene: 55826
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll2, bapa, Mll4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
Homologene: 86893
Name: SH3 and PX domains 2B
Synonyms: G431001E03Rik, Fad49, Tks4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268396
Homologene: 27952
Name: solute carrier family 6 (neurotransmitter transporter, L-proline), member 7
Synonyms: Prot
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240332
VEGA: 18
Homologene: 8592
Name: murinoglobulin 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17837
Homologene: 136663
Name: periostin, osteoblast specific factor
Synonyms: Periostin, Osf2, OSF-2, A630052E07Rik, peri
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 50706
Homologene: 4730
Name: cytochrome P450, family 2, subfamily b, polypeptide 23
Synonyms: EG243881
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243881
Homologene: 117483
Name: sorting nexin 19
Synonyms: 3526401K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102607
Homologene: 8846
Name: collagen, type V, alpha 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12831
Homologene: 55434
Name: interactor of HORMAD1 1
Synonyms: Iho1, Ccdc36
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 434438
Homologene: 52256
Name: dCMP deaminase
Synonyms: 6030466N05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320685
Homologene: 55618
Name: ATP-binding cassette, sub-family C member 3
Synonyms: MRP3, 1700019L09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76408
Homologene: 68364
Name: calpain 9
Synonyms: GC36, nCL-4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73647
Homologene: 38208
Name: zinc finger protein 956
Synonyms: AI894139
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101197
Homologene: 128449
Name: clusterin associated protein 1
Synonyms: 2610111M03Rik, 2310030D15Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 76779
Homologene: 14831
Name: amine oxidase copper containing 1-like 1
Synonyms: Doxl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243376
Homologene: 19443
Name: macrophage stimulating 1 (hepatocyte growth factor-like)
Synonyms: D3F15S2h, DNF15S2h, D9H3F15S2, Hgfl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15235
Homologene: 7360
Name: IQ motif containing with AAA domain 1 like
Synonyms: 4931409K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231045
Homologene: 18602
Name: F-box and leucine-rich repeat protein 12
Synonyms: 3110048D16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 30843
Homologene: 32198
Name: glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)
Synonyms: LOC218476, C2GNT3, Gm73, LOC238786
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218476
VEGA: 13
Homologene: 41144
Name: centrosomal protein 250
Synonyms: Cep2, B230210E21Rik, Inmp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16328
Homologene: 38286
Name: AADACL4 family member 4
Synonyms: LOC230890, Gm436
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230890
Homologene: 135765
Name: T cell immunoreceptor with Ig and ITIM domains
Synonyms: Vstm3, ENSMUSG00000071552
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 100043314
VEGA: 16
Homologene: 18358
Name: vav 3 oncogene
Synonyms: Idd18.1, A530094I06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 57257
Homologene: 38143
Name: keratin 39
Synonyms: 4732494G06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237934
Homologene: 19078
Name: trypsin 4
Synonyms: Td, 0910001B19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22074
Homologene: 106639
Name: fibroblast growth factor (acidic) intracellular binding protein
Synonyms: 3010027N18Rik, 2010005N21Rik, 2010004G08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58249
VEGA: 19
Homologene: 3106
Name: vezatin, adherens junctions transmembrane protein
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215008
Homologene: 9739
Name: H1.7 linker histone
Synonyms: H1T2, 1700026P10Rik, H1-7, H1fnt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70069
VEGA: 15
Name: olfactory receptor family 1 subfamily E member 25
Synonyms: GA_x6K02T2P1NL-3773152-3774090, MOR135-5, Olfr386, Olfr384, GA_x6K02T2P1NL-3739520-3740032
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193053
Homologene: 105206
Name: phospholipase A2, group IVF
Synonyms: 4732472I07Rik, Pla2zeta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271844
Homologene: 77933
Name: MAX-like protein X
Synonyms: BigMax alpha, Tcfl4, bHLHd13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21428
Homologene: 7969
Name: SUMO/sentrin specific peptidase 2-like 2A
Synonyms: AF366264
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 231201
Homologene: 130042
Name: immunoglobulin kappa chain variable 13-84
Synonyms: Igk-V33
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 692152
Name: mitochondrial ribosomal protein S10
Synonyms: Rpms10, 1110038B19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64657
Homologene: 10028
Name: keratin associated protein 4-9
Synonyms: OTTMUSG00000002198
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 665998
Name: dynein, axonemal, heavy chain 7C
Synonyms: Dnahc7c
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100101919
Homologene: 41287
Name: SET binding protein 1
Synonyms: Seb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240427
Homologene: 9192
Name: isovaleryl coenzyme A dehydrogenase
Synonyms: 6720455E18Rik, 1300016K07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56357
Homologene: 1676
Name: caspase recruitment domain family, member 9
Synonyms: LOC332579
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 332579
Homologene: 14150
Name: transmembrane protein 181A
Synonyms: 5930418K15Rik, Tmem181, Gpr178, C76977
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77106
Homologene: 44787
Name: olfactory receptor family 3 subfamily A member 1C
Synonyms: GA_x6K02T2P1NL-4307199-4308146, Olfr402, MOR255-4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258703
Homologene: 1915
Name: coiled-coil domain containing 87
Synonyms: 4931419P11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 399599
VEGA: 19
Homologene: 49531
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, 4930485B16Rik, Gm872
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Name: aldolase C, fructose-bisphosphate
Synonyms: Aldo3, zebrin II, Scrg2, Aldolase C
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11676
Homologene: 21073
Name: pre T cell antigen receptor alpha
Synonyms: pTalpha, pT-alpha, pT[a]
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19208
Homologene: 22621
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 46,681,772 bp
  • A to T, chromosome 1 at 53,865,121 bp
  • C to G, chromosome 2 at 5,904,070 bp
  • T to C, chromosome 2 at 14,449,803 bp
  • G to A, chromosome 2 at 26,358,835 bp
  • A to G, chromosome 2 at 27,929,486 bp
  • C to A, chromosome 2 at 118,869,774 bp
  • T to C, chromosome 2 at 120,304,554 bp
  • A to T, chromosome 2 at 122,121,782 bp
  • T to C, chromosome 2 at 155,965,077 bp
  • T to A, chromosome 3 at 29,980,945 bp
  • T to C, chromosome 3 at 54,362,635 bp
  • T to C, chromosome 3 at 55,121,799 bp
  • T to A, chromosome 3 at 89,346,980 bp
  • T to A, chromosome 3 at 109,664,346 bp
  • C to T, chromosome 3 at 138,116,132 bp
  • T to C, chromosome 3 at 145,648,781 bp
  • A to G, chromosome 4 at 40,279,336 bp
  • A to G, chromosome 4 at 55,009,380 bp
  • C to T, chromosome 4 at 76,066,340 bp
  • T to A, chromosome 4 at 106,382,303 bp
  • A to G, chromosome 4 at 144,670,067 bp
  • A to G, chromosome 5 at 24,548,956 bp
  • A to T, chromosome 5 at 35,571,066 bp
  • A to G, chromosome 5 at 37,410,258 bp
  • G to A, chromosome 5 at 65,977,141 bp
  • A to T, chromosome 5 at 149,193,935 bp
  • T to C, chromosome 6 at 41,304,403 bp
  • C to A, chromosome 6 at 47,955,847 bp
  • T to A, chromosome 6 at 48,976,372 bp
  • T to C, chromosome 6 at 55,092,127 bp
  • C to G, chromosome 6 at 58,887,424 bp
  • T to A, chromosome 6 at 68,939,780 bp
  • T to C, chromosome 6 at 122,075,247 bp
  • A to T, chromosome 6 at 145,177,406 bp
  • C to A, chromosome 7 at 26,449,833 bp
  • A to G, chromosome 7 at 26,681,413 bp
  • A to G, chromosome 7 at 82,658,064 bp
  • G to T, chromosome 7 at 86,726,112 bp
  • A to G, chromosome 7 at 107,184,814 bp
  • AAGCAGCAGCAGCAGCAGCAG to AAGCAGCAGCAGCAGCAG, chromosome 7 at 127,796,418 bp
  • T to A, chromosome 7 at 128,779,640 bp
  • A to T, chromosome 8 at 13,836,982 bp
  • A to G, chromosome 8 at 48,112,040 bp
  • T to A, chromosome 8 at 75,057,249 bp
  • C to A, chromosome 8 at 84,095,079 bp
  • A to T, chromosome 8 at 124,576,278 bp
  • T to A, chromosome 9 at 7,075,786 bp
  • G to A, chromosome 9 at 20,644,383 bp
  • T to A, chromosome 9 at 20,891,154 bp
  • C to T, chromosome 9 at 21,794,679 bp
  • T to G, chromosome 9 at 30,427,893 bp
  • A to G, chromosome 9 at 108,084,931 bp
  • A to T, chromosome 9 at 108,417,420 bp
  • A to G, chromosome 9 at 109,007,302 bp
  • T to C, chromosome 9 at 109,060,420 bp
  • T to C, chromosome 10 at 5,228,221 bp
  • A to G, chromosome 10 at 80,792,341 bp
  • T to C, chromosome 10 at 92,821,104 bp
  • A to T, chromosome 10 at 93,970,547 bp
  • A to G, chromosome 11 at 9,291,893 bp
  • A to G, chromosome 11 at 32,422,072 bp
  • A to T, chromosome 11 at 73,602,736 bp
  • A to T, chromosome 11 at 73,887,954 bp
  • A to G, chromosome 11 at 74,155,780 bp
  • A to G, chromosome 11 at 78,324,456 bp
  • T to C, chromosome 11 at 80,395,528 bp
  • A to T, chromosome 11 at 94,365,031 bp
  • G to A, chromosome 11 at 99,004,182 bp
  • C to T, chromosome 11 at 99,520,871 bp
  • C to T, chromosome 11 at 99,785,457 bp
  • C to T, chromosome 11 at 101,089,242 bp
  • C to T, chromosome 11 at 118,079,658 bp
  • A to T, chromosome 13 at 11,640,327 bp
  • A to G, chromosome 13 at 11,668,811 bp
  • A to T, chromosome 13 at 21,525,273 bp
  • A to T, chromosome 13 at 54,784,100 bp
  • A to T, chromosome 13 at 56,251,750 bp
  • A to T, chromosome 13 at 96,946,519 bp
  • T to C, chromosome 14 at 23,367,494 bp
  • T to C, chromosome 14 at 64,773,068 bp
  • A to T, chromosome 15 at 75,918,695 bp
  • T to A, chromosome 15 at 98,256,369 bp
  • GCTGCTGCT to GCTGCTGCTCCTGCTGCT, chromosome 15 at 98,849,616 bp
  • A to T, chromosome 15 at 98,906,323 bp
  • C to T, chromosome 16 at 3,940,775 bp
  • C to A, chromosome 16 at 43,662,252 bp
  • A to C, chromosome 16 at 96,066,498 bp
  • T to A, chromosome 17 at 6,297,972 bp
  • T to A, chromosome 17 at 20,889,878 bp
  • T to A, chromosome 17 at 32,144,217 bp
  • C to G, chromosome 17 at 46,763,596 bp
  • T to C, chromosome 17 at 47,375,015 bp
  • C to T, chromosome 17 at 56,617,814 bp
  • T to C, chromosome 18 at 61,002,202 bp
  • A to G, chromosome 18 at 79,086,960 bp
  • T to A, chromosome 19 at 3,815,412 bp
  • A to T, chromosome 19 at 4,749,460 bp
  • A to G, chromosome 19 at 4,841,757 bp
  • T to A, chromosome 19 at 5,461,491 bp
  • T to A, chromosome 19 at 27,768,628 bp
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact Older strains may not have this information.
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7131 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email
Coat Color
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045216-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.