Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7131Btlr/Mmmh
Stock Number:
045216-MU
Citation ID:
RRID:MMRRC_045216-MU
Other Names:
R7131 (G1)
Major Collection:

Strain Information

Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Crhr2
Name: corticotropin releasing hormone receptor 2
Synonyms: Crfr2, CRF-R2, CRFR2beta, CRFR2alpha, CRF 2 receptor, CRH-R2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12922
HGNC: HGNC:2358
Homologene: 55612
Neurog1
Name: neurogenin 1
Synonyms: neurogenin, Math4C, ngn1, neurogenin 1, Neurod3, bHLHa6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18014
VEGA: 13
HGNC: HGNC:7764
Homologene: 4490
Chrna9
Name: cholinergic receptor, nicotinic, alpha polypeptide 9
Synonyms: Acra9, 2410015I05Rik, Gm8311
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231252
Homologene: 9729
Herc3
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73998
HGNC: HGNC:4876
Homologene: 57095
Rfx3
Name: regulatory factor X, 3 (influences HLA class II expression)
Synonyms: MRFX3, C230093O12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19726
HGNC: HGNC:9984
Homologene: 7917
Ccn1
Name: cellular communication network factor 1
Synonyms: CCN1, Cyr61
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16007
HGNC: HGNC:2654
Homologene: 1194
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 46,681,772 bp
  • A to T, chromosome 1 at 53,865,121 bp
  • C to G, chromosome 2 at 5,904,070 bp
  • T to C, chromosome 2 at 14,449,803 bp
  • G to A, chromosome 2 at 26,358,835 bp
  • A to G, chromosome 2 at 27,929,486 bp
  • C to A, chromosome 2 at 118,869,774 bp
  • T to C, chromosome 2 at 120,304,554 bp
  • A to T, chromosome 2 at 122,121,782 bp
  • T to C, chromosome 2 at 155,965,077 bp
  • T to A, chromosome 3 at 29,980,945 bp
  • T to C, chromosome 3 at 54,362,635 bp
  • T to C, chromosome 3 at 55,121,799 bp
  • T to A, chromosome 3 at 89,346,980 bp
  • T to A, chromosome 3 at 109,664,346 bp
  • C to T, chromosome 3 at 138,116,132 bp
  • T to C, chromosome 3 at 145,648,781 bp
  • A to G, chromosome 4 at 40,279,336 bp
  • A to G, chromosome 4 at 55,009,380 bp
  • C to T, chromosome 4 at 76,066,340 bp
  • T to A, chromosome 4 at 106,382,303 bp
  • A to G, chromosome 4 at 144,670,067 bp
  • A to G, chromosome 5 at 24,548,956 bp
  • A to T, chromosome 5 at 35,571,066 bp
  • A to G, chromosome 5 at 37,410,258 bp
  • G to A, chromosome 5 at 65,977,141 bp
  • A to T, chromosome 5 at 149,193,935 bp
  • T to C, chromosome 6 at 41,304,403 bp
  • C to A, chromosome 6 at 47,955,847 bp
  • T to A, chromosome 6 at 48,976,372 bp
  • T to C, chromosome 6 at 55,092,127 bp
  • C to G, chromosome 6 at 58,887,424 bp
  • T to A, chromosome 6 at 68,939,780 bp
  • T to C, chromosome 6 at 122,075,247 bp
  • A to T, chromosome 6 at 145,177,406 bp
  • C to A, chromosome 7 at 26,449,833 bp
  • A to G, chromosome 7 at 26,681,413 bp
  • A to G, chromosome 7 at 82,658,064 bp
  • G to T, chromosome 7 at 86,726,112 bp
  • A to G, chromosome 7 at 107,184,814 bp
  • AAGCAGCAGCAGCAGCAGCAG to AAGCAGCAGCAGCAGCAG, chromosome 7 at 127,796,418 bp
  • T to A, chromosome 7 at 128,779,640 bp
  • A to T, chromosome 8 at 13,836,982 bp
  • A to G, chromosome 8 at 48,112,040 bp
  • T to A, chromosome 8 at 75,057,249 bp
  • C to A, chromosome 8 at 84,095,079 bp
  • A to T, chromosome 8 at 124,576,278 bp
  • T to A, chromosome 9 at 7,075,786 bp
  • G to A, chromosome 9 at 20,644,383 bp
  • T to A, chromosome 9 at 20,891,154 bp
  • C to T, chromosome 9 at 21,794,679 bp
  • T to G, chromosome 9 at 30,427,893 bp
  • A to G, chromosome 9 at 108,084,931 bp
  • A to T, chromosome 9 at 108,417,420 bp
  • A to G, chromosome 9 at 109,007,302 bp
  • T to C, chromosome 9 at 109,060,420 bp
  • T to C, chromosome 10 at 5,228,221 bp
  • A to G, chromosome 10 at 80,792,341 bp
  • T to C, chromosome 10 at 92,821,104 bp
  • A to T, chromosome 10 at 93,970,547 bp
  • A to G, chromosome 11 at 9,291,893 bp
  • A to G, chromosome 11 at 32,422,072 bp
  • A to T, chromosome 11 at 73,602,736 bp
  • A to T, chromosome 11 at 73,887,954 bp
  • A to G, chromosome 11 at 74,155,780 bp
  • A to G, chromosome 11 at 78,324,456 bp
  • T to C, chromosome 11 at 80,395,528 bp
  • A to T, chromosome 11 at 94,365,031 bp
  • G to A, chromosome 11 at 99,004,182 bp
  • C to T, chromosome 11 at 99,520,871 bp
  • C to T, chromosome 11 at 99,785,457 bp
  • C to T, chromosome 11 at 101,089,242 bp
  • C to T, chromosome 11 at 118,079,658 bp
  • A to T, chromosome 13 at 11,640,327 bp
  • A to G, chromosome 13 at 11,668,811 bp
  • A to T, chromosome 13 at 21,525,273 bp
  • A to T, chromosome 13 at 54,784,100 bp
  • A to T, chromosome 13 at 56,251,750 bp
  • A to T, chromosome 13 at 96,946,519 bp
  • T to C, chromosome 14 at 23,367,494 bp
  • T to C, chromosome 14 at 64,773,068 bp
  • A to T, chromosome 15 at 75,918,695 bp
  • T to A, chromosome 15 at 98,256,369 bp
  • GCTGCTGCT to GCTGCTGCTCCTGCTGCT, chromosome 15 at 98,849,616 bp
  • A to T, chromosome 15 at 98,906,323 bp
  • C to T, chromosome 16 at 3,940,775 bp
  • C to A, chromosome 16 at 43,662,252 bp
  • A to C, chromosome 16 at 96,066,498 bp
  • T to A, chromosome 17 at 6,297,972 bp
  • T to A, chromosome 17 at 20,889,878 bp
  • T to A, chromosome 17 at 32,144,217 bp
  • C to G, chromosome 17 at 46,763,596 bp
  • T to C, chromosome 17 at 47,375,015 bp
  • C to T, chromosome 17 at 56,617,814 bp
  • T to C, chromosome 18 at 61,002,202 bp
  • A to G, chromosome 18 at 79,086,960 bp
  • T to A, chromosome 19 at 3,815,412 bp
  • A to T, chromosome 19 at 4,749,460 bp
  • A to G, chromosome 19 at 4,841,757 bp
  • T to A, chromosome 19 at 5,461,491 bp
  • T to A, chromosome 19 at 27,768,628 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7131 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045216-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.