Strain Name:
C57BL/6J-MtgxR7167Btlr/Mmmh
Stock Number:
045228-MU
Citation ID:
RRID:MMRRC_045228-MU
Other Names:
R7167 (G1)
Major Collection:

Strain Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Del1, Col2a-1, Col2a, Col2, M100856, Rgsc856, Lpk, M100413, Rgsc413
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
Hfe
Name: homeostatic iron regulator
Synonyms: MR2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15216
HGNC: HGNC:4886
Homologene: 88330
Pip5k1b
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 beta
Synonyms: Pipk5b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18719
HGNC: HGNC:8995
Homologene: 100644
U2surp
Name: U2 snRNP-associated SURP domain containing
Synonyms: 2610101N10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67958
Homologene: 13964
Thada
Name: thyroid adenoma associated
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240174
VEGA: 17
Homologene: 75175
Thrap3
Name: thyroid hormone receptor associated protein 3
Synonyms: 9330151F09Rik, Trap150, B230333E16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230753
Homologene: 31289
Tnks
Name: tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms: 4930554K12Rik, D130072O21Rik, tankyrase 1, TANK1, mTNKS1, Parp5a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21951
Homologene: 18405
Wdr48
Name: WD repeat domain 48
Synonyms: 8430408H12Rik, Uaf1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67561
VEGA: 9
Homologene: 10830
Daam1
Name: dishevelled associated activator of morphogenesis 1
Synonyms: 1700066F09Rik, 2310028E21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 208846
VEGA: 12
Homologene: 36635
Zfr
Name: zinc finger RNA binding protein
Synonyms: C920030H05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22763
Homologene: 8009
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Cux1
Name: cut-like homeobox 1
Synonyms: Cux, CDP, Cux-1, Cutl1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13047
HGNC: HGNC:2557
Atxn2l
Name: ataxin 2-like
Synonyms: A2RP, A2LG, A2D, A2lp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233871
Homologene: 16513
Stag1
Name: STAG1 cohesin complex component
Synonyms: SA-1, Scc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20842
Homologene: 21191
Rims2
Name: regulating synaptic membrane exocytosis 2
Synonyms: RIM2, 2810036I15Rik, Syt3-rs
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 116838
VEGA: 15
Homologene: 81639
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Abcc5
Name: ATP-binding cassette, sub-family C member 5
Synonyms: Mrp5, Abcc5b, Abcc5a, 2900011L11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27416
HGNC: HGNC:56
Homologene: 21164
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Clca2
Name: chloride channel accessory 2
Synonyms: Clca5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229933
HGNC: HGNC:2016
Homologene: 4765
Vps50
Name: VPS50 EARP/GARPII complex subunit
Synonyms: 8430415E05Rik, 1700034M03Rik, Ccdc132
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73288
Homologene: 11498
Trpm4
Name: transient receptor potential cation channel, subfamily M, member 4
Synonyms: TRPM4B, 1110030C19Rik, LTRPC4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68667
Homologene: 23033
Acsbg2
Name: acyl-CoA synthetase bubblegum family member 2
Synonyms: Bgr
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328845
Homologene: 57133
Arhgef2
Name: Rho/Rac guanine nucleotide exchange factor 2
Synonyms: Lfc, GEF-H1, LFP40, GEFH1, P40, Lbcl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16800
HGNC: HGNC:682
Homologene: 3468
Fut8
Name: fucosyltransferase 8
Synonyms: alpha (1,6) fucosyltransferase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 53618
VEGA: 12
HGNC: HGNC:4019
Homologene: 9650
Trap1
Name: TNF receptor-associated protein 1
Synonyms: HSP75, 2410002K23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68015
Homologene: 9457
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Smad3
Name: SMAD family member 3
Synonyms: Smad 3, Madh3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17127
HGNC: HGNC:6769
Homologene: 55937
Optn
Name: optineurin
Synonyms: 4930441O07Rik, TFIIIA-INTP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71648
Homologene: 11085
Reln
Name: reelin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19699
HGNC: HGNC:9957
Homologene: 3699
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Ralgapa2
Name: Ral GTPase activating protein, alpha subunit 2 (catalytic)
Synonyms: A230067G21Rik, RGC2, AS250
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241694
Homologene: 28131
Bmpr1b
Name: bone morphogenetic protein receptor, type 1B
Synonyms: Alk6, CFK-43a, Acvrlk6, BMPR-IB
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12167
HGNC: HGNC:1077
Homologene: 20322
A2m
Name: alpha-2-macroglobulin
Synonyms: A2mp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232345
HGNC: HGNC:7
Homologene: 37248
Vmn2r110
Name: vomeronasal 2, receptor 110
Synonyms: EG224582
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224582
Homologene: 129678
Oas1e
Name: 2'-5' oligoadenylate synthetase 1E
Synonyms: 2'-5' oligoadenylate synthetase-like 7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231699
HGNC: HGNC:8086
Homologene: 110815
Usp12
Name: ubiquitin specific peptidase 12
Synonyms: Ubh1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22217
Homologene: 56137
Or13a20
Name: olfactory receptor family 13 subfamily A member 20
Synonyms: IE12, MOR253-5, GA_x6K02T2PBJ9-42798103-42799038, Olfr53
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258962
Homologene: 133678
Alpk2
Name: alpha-kinase 2
Synonyms: Hak
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225638
Homologene: 50475
Or8g4
Name: olfactory receptor family 8 subfamily G member 4
Synonyms: GA_x6K02T2PVTD-33447884-33448816, MOR171-30P, Olfr967
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258086
VEGA: 9
HGNC: HGNC:8484
Homologene: 115535
Tbx18
Name: T-box18
Synonyms: 2810012F10Rik, 2810404D13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76365
Homologene: 11384
Or4p18
Name: olfactory receptor family 4 subfamily P member 18
Synonyms: GA_x6K02T2Q125-49890854-49889931, MOR225-2, Olfr1179
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258919
Homologene: 74070
Meiob
Name: meiosis specific with OB domains
Synonyms: 4930528F23Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75178
VEGA: 17
Homologene: 102013
Spata7
Name: spermatogenesis associated 7
Synonyms: HSD3, B230306G18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104871
Homologene: 10189
Or4g16
Name: olfactory receptor family 4 subfamily G member 16
Synonyms: GA_x6K02T2Q125-72357646-72358581, MOR245-12, Olfr1279
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258388
Homologene: 121520
Ppm1n
Name: protein phosphatase, Mg2+/Mn2+ dependent, 1N (putative)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232941
Homologene: 58958
Radil
Name: Ras association and DIL domains
Synonyms: D930005D10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231858
Homologene: 77648
Or6c66b
Name: olfactory receptor family 6 subfamily C member 66B
Synonyms: GA_x6K02T2PULF-11219415-11220350, MOR108-2, Olfr792
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258150
Homologene: 133881
Cyp2u1
Name: cytochrome P450, family 2, subfamily u, polypeptide 1
Synonyms: 8430436A10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71519
Homologene: 77704
Ergic2
Name: ERGIC and golgi 2
Synonyms: 4930572C01Rik, 1200009B18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67456
Homologene: 6574
Rtp3
Name: receptor transporter protein 3
Synonyms: Tmem7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235636
Homologene: 135957
Nanos1
Name: nanos C2HC-type zinc finger 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 332397
VEGA: 19
Homologene: 131234
Plau
Name: plasminogen activator, urokinase
Synonyms: uPA, u-PA, urokinase-type plasminogen activator
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18792
VEGA: 14
HGNC: HGNC:9052
Homologene: 55670
Naprt
Name: nicotinate phosphoribosyltransferase
Synonyms: 9130210N20Rik, Naprt1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223646
VEGA: 15
Homologene: 82285
Pex13
Name: peroxisomal biogenesis factor 13
Synonyms: 2610008O20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72129
HGNC: HGNC:8855
Homologene: 1967
Or1l8
Name: olfactory receptor family 1 subfamily L member 8
Synonyms: GA_x6K02T2NLDC-33622642-33621710, MOR138-2, Olfr355
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258618
Homologene: 132326
Mkrn2os
Name: makorin, ring finger protein 2, opposite strand
Synonyms: 2510049J12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70291
Homologene: 66298
Oxnad1
Name: oxidoreductase NAD-binding domain containing 1
Synonyms: 2410002F01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218885
Homologene: 16303
Krt75
Name: keratin 75
Synonyms: Krt2-6hf, 4732468K03Rik, Krtcap1, K6hf
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 109052
Homologene: 20983
Vmn1r200
Name: vomeronasal 1 receptor 200
Synonyms: V1rh3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171246
Homologene: 110880
Ifih1
Name: interferon induced with helicase C domain 1
Synonyms: Helicard, MDA5, MDA-5, 9130009C22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71586
Homologene: 32535
Oog2
Name: oogenesin 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381570
Homologene: 77858
Zfp446
Name: zinc finger protein 446
Synonyms: A630035I11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269870
Homologene: 9910
Shisal2b
Name: shisa like 2B
Synonyms: A930021C24Rik, Fam159b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 77803
VEGA: 13
Homologene: 19019
Rnase2b
Name: ribonuclease, RNase A family, 2B (liver, eosinophil-derived neurotoxin)
Synonyms: murine ribonuclease 5, mR5, Ear5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54159
VEGA: 14
Homologene: 121614
Pcdha3
Name: protocadherin alpha 3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 192163
HGNC: HGNC:8669
Homologene: 129613
Ftl1
Name: ferritin light polypeptide 1
Synonyms: Ftl, L-ferritin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14325
HGNC: HGNC:3999
Homologene: 79330
Gm28363
Name: predicted gene 28363
Type: Gene
Species: Mouse
Chromosome: 1
Or6c63-ps1
Name: olfactory receptor family 6 subfamily C member 63, pseudogene 1
Synonyms: GA_x6K02T2PULF-10749079-10748573, MOR115-2, EG544748, EG546487, Olfr766, Olfr766-ps1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 546487
Homologene: 67771
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 53,503,776 bp
  • T to C, chromosome 1 at 117,727,389 bp
  • T to C, chromosome 2 at 5,042,483 bp
  • T to C, chromosome 2 at 36,927,521 bp
  • A to T, chromosome 2 at 62,598,896 bp
  • A to G, chromosome 2 at 88,402,208 bp
  • T to C, chromosome 2 at 111,306,448 bp
  • C to T, chromosome 2 at 146,348,454 bp
  • A to G, chromosome 3 at 88,643,872 bp
  • A to G, chromosome 3 at 131,303,124 bp
  • A to T, chromosome 3 at 141,863,080 bp
  • T to C, chromosome 3 at 145,097,784 bp
  • A to C, chromosome 4 at 126,185,127 bp
  • T to G, chromosome 4 at 144,195,175 bp
  • A to T, chromosome 5 at 21,942,620 bp
  • G to A, chromosome 5 at 94,317,125 bp
  • G to T, chromosome 5 at 120,795,422 bp
  • G to A, chromosome 5 at 136,310,041 bp
  • G to T, chromosome 5 at 142,485,505 bp
  • G to T, chromosome 5 at 144,839,614 bp
  • A to G, chromosome 5 at 146,768,935 bp
  • C to T, chromosome 6 at 3,600,256 bp
  • A to T, chromosome 6 at 115,585,513 bp
  • T to C, chromosome 6 at 121,647,971 bp
  • T to C, chromosome 6 at 148,206,635 bp
  • C to T, chromosome 7 at 12,978,122 bp
  • A to G, chromosome 7 at 19,279,741 bp
  • A to G, chromosome 7 at 45,327,719 bp
  • T to A, chromosome 7 at 45,459,778 bp
  • T to C, chromosome 7 at 126,499,222 bp
  • T to A, chromosome 7 at 140,652,553 bp
  • A to G, chromosome 8 at 15,926,524 bp
  • G to A, chromosome 8 at 34,849,304 bp
  • T to C, chromosome 9 at 39,750,569 bp
  • T to A, chromosome 9 at 63,666,153 bp
  • C to T, chromosome 9 at 87,707,830 bp
  • A to T, chromosome 9 at 95,481,673 bp
  • T to G, chromosome 9 at 100,945,889 bp
  • T to A, chromosome 9 at 110,986,704 bp
  • T to A, chromosome 9 at 119,907,789 bp
  • T to G, chromosome 10 at 129,063,272 bp
  • T to C, chromosome 10 at 129,540,738 bp
  • A to T, chromosome 11 at 23,655,472 bp
  • T to C, chromosome 11 at 55,285,001 bp
  • C to A, chromosome 12 at 71,988,904 bp
  • T to C, chromosome 12 at 77,448,632 bp
  • T to G, chromosome 12 at 98,664,296 bp
  • A to G, chromosome 13 at 22,395,317 bp
  • A to T, chromosome 13 at 23,708,069 bp
  • A to G, chromosome 13 at 104,863,658 bp
  • C to A, chromosome 14 at 20,839,450 bp
  • G to T, chromosome 14 at 32,101,019 bp
  • T to A, chromosome 14 at 51,162,765 bp
  • T to C, chromosome 15 at 12,180,929 bp
  • T to C, chromosome 15 at 39,437,077 bp
  • C to T, chromosome 15 at 75,892,612 bp
  • A to G, chromosome 15 at 98,000,456 bp
  • A to G, chromosome 15 at 101,568,315 bp
  • A to C, chromosome 16 at 4,052,928 bp
  • T to C, chromosome 16 at 20,405,501 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • C to T, chromosome 17 at 20,574,179 bp
  • T to G, chromosome 17 at 24,836,445 bp
  • T to A, chromosome 17 at 56,857,000 bp
  • C to T, chromosome 17 at 84,230,963 bp
  • G to A, chromosome 18 at 36,946,993 bp
  • G to T, chromosome 18 at 65,306,978 bp
  • T to A, chromosome 19 at 24,397,069 bp
  • G to T, chromosome 19 at 60,756,608 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7167 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045228-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.