Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7167Btlr/Mmmh
Stock Number:
045228-MU
Citation ID:
RRID:MMRRC_045228-MU
Other Names:
R7167 (G1)
Major Collection:

Strain Information

Col2a1
Name: collagen, type II, alpha 1
Synonyms: Del1, Col2a-1, Col2a, Col2, M100856, Rgsc856, Lpk, M100413, Rgsc413
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12824
HGNC: HGNC:2200
Homologene: 55607
Hfe
Name: homeostatic iron regulator
Synonyms: MR2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15216
HGNC: HGNC:4886
Homologene: 88330
Pip5k1b
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 beta
Synonyms: Pipk5b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18719
HGNC: HGNC:8995
Homologene: 100644
U2surp
Name: U2 snRNP-associated SURP domain containing
Synonyms: 2610101N10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67958
Homologene: 13964
Thada
Name: thyroid adenoma associated
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240174
VEGA: 17
Homologene: 75175
Thrap3
Name: thyroid hormone receptor associated protein 3
Synonyms: 9330151F09Rik, Trap150, B230333E16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230753
Homologene: 31289
Tnks
Name: tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms: 4930554K12Rik, D130072O21Rik, tankyrase 1, TANK1, mTNKS1, Parp5a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21951
Homologene: 18405
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 53,503,776 bp
  • T to C, chromosome 1 at 117,727,389 bp
  • T to C, chromosome 2 at 5,042,483 bp
  • T to C, chromosome 2 at 36,927,521 bp
  • A to T, chromosome 2 at 62,598,896 bp
  • A to G, chromosome 2 at 88,402,208 bp
  • T to C, chromosome 2 at 111,306,448 bp
  • C to T, chromosome 2 at 146,348,454 bp
  • A to G, chromosome 3 at 88,643,872 bp
  • A to G, chromosome 3 at 131,303,124 bp
  • A to T, chromosome 3 at 141,863,080 bp
  • T to C, chromosome 3 at 145,097,784 bp
  • A to C, chromosome 4 at 126,185,127 bp
  • T to G, chromosome 4 at 144,195,175 bp
  • A to T, chromosome 5 at 21,942,620 bp
  • G to A, chromosome 5 at 94,317,125 bp
  • G to T, chromosome 5 at 120,795,422 bp
  • G to A, chromosome 5 at 136,310,041 bp
  • G to T, chromosome 5 at 142,485,505 bp
  • G to T, chromosome 5 at 144,839,614 bp
  • A to G, chromosome 5 at 146,768,935 bp
  • C to T, chromosome 6 at 3,600,256 bp
  • A to T, chromosome 6 at 115,585,513 bp
  • T to C, chromosome 6 at 121,647,971 bp
  • T to C, chromosome 6 at 148,206,635 bp
  • C to T, chromosome 7 at 12,978,122 bp
  • A to G, chromosome 7 at 19,279,741 bp
  • A to G, chromosome 7 at 45,327,719 bp
  • T to A, chromosome 7 at 45,459,778 bp
  • T to C, chromosome 7 at 126,499,222 bp
  • T to A, chromosome 7 at 140,652,553 bp
  • A to G, chromosome 8 at 15,926,524 bp
  • G to A, chromosome 8 at 34,849,304 bp
  • T to C, chromosome 9 at 39,750,569 bp
  • T to A, chromosome 9 at 63,666,153 bp
  • C to T, chromosome 9 at 87,707,830 bp
  • A to T, chromosome 9 at 95,481,673 bp
  • T to G, chromosome 9 at 100,945,889 bp
  • T to A, chromosome 9 at 110,986,704 bp
  • T to A, chromosome 9 at 119,907,789 bp
  • T to G, chromosome 10 at 129,063,272 bp
  • T to C, chromosome 10 at 129,540,738 bp
  • A to T, chromosome 11 at 23,655,472 bp
  • T to C, chromosome 11 at 55,285,001 bp
  • C to A, chromosome 12 at 71,988,904 bp
  • T to C, chromosome 12 at 77,448,632 bp
  • T to G, chromosome 12 at 98,664,296 bp
  • A to G, chromosome 13 at 22,395,317 bp
  • A to T, chromosome 13 at 23,708,069 bp
  • A to G, chromosome 13 at 104,863,658 bp
  • C to A, chromosome 14 at 20,839,450 bp
  • G to T, chromosome 14 at 32,101,019 bp
  • T to A, chromosome 14 at 51,162,765 bp
  • T to C, chromosome 15 at 12,180,929 bp
  • T to C, chromosome 15 at 39,437,077 bp
  • C to T, chromosome 15 at 75,892,612 bp
  • A to G, chromosome 15 at 98,000,456 bp
  • A to G, chromosome 15 at 101,568,315 bp
  • A to C, chromosome 16 at 4,052,928 bp
  • T to C, chromosome 16 at 20,405,501 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • C to T, chromosome 17 at 20,574,179 bp
  • T to G, chromosome 17 at 24,836,445 bp
  • T to A, chromosome 17 at 56,857,000 bp
  • C to T, chromosome 17 at 84,230,963 bp
  • G to A, chromosome 18 at 36,946,993 bp
  • G to T, chromosome 18 at 65,306,978 bp
  • T to A, chromosome 19 at 24,397,069 bp
  • G to T, chromosome 19 at 60,756,608 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7167 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045228-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.