Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7185Btlr/Mmmh
Stock Number:
045237-MU
Citation ID:
RRID:MMRRC_045237-MU
Other Names:
R7185 (G1)
Major Collection:

Strain Information

Rest
Name: RE1-silencing transcription factor
Synonyms: 2610008J04Rik, NRSF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19712
HGNC: HGNC:9966
Homologene: 4099
Pdzk1ip1
Name: PDZK1 interacting protein 1
Synonyms: 0610007F13Rik, 2700030M23Rik, Map17
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67182
Homologene: 4213
Srd5a3
Name: steroid 5 alpha-reductase 3
Synonyms: D730040M03Rik, 1110025P14Rik, Srd5a2l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57357
Homologene: 41385
Kcnj5
Name: potassium inwardly-rectifying channel, subfamily J, member 5
Synonyms: Kir3.4, GIRK4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16521
VEGA: 9
HGNC: HGNC:6266
Homologene: 20248
Xpa
Name: xeroderma pigmentosum, complementation group A
Synonyms: Xpac
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22590
Homologene: 37298
Pibf1
Name: progesterone immunomodulatory binding factor 1
Synonyms: 1700017E21Rik, 4933438D16Rik, 4933439E17Rik, 4930513H15Rik, D14Ertd581e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52023
VEGA: 14
Homologene: 4628
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 6,238,383 bp
  • A to C, chromosome 1 at 23,763,191 bp
  • A to T, chromosome 1 at 33,769,893 bp
  • T to C, chromosome 1 at 135,471,008 bp
  • C to A, chromosome 1 at 169,987,054 bp
  • T to C, chromosome 1 at 187,226,197 bp
  • A to G, chromosome 1 at 189,653,489 bp
  • A to G, chromosome 2 at 26,220,706 bp
  • T to C, chromosome 2 at 34,775,126 bp
  • C to T, chromosome 2 at 40,801,512 bp
  • T to A, chromosome 2 at 66,687,795 bp
  • A to G, chromosome 2 at 87,738,145 bp
  • T to G, chromosome 2 at 111,873,822 bp
  • A to G, chromosome 2 at 164,893,244 bp
  • T to A, chromosome 2 at 172,982,192 bp
  • T to C, chromosome 3 at 116,294,027 bp
  • A to G, chromosome 4 at 43,706,082 bp
  • G to T, chromosome 4 at 46,183,078 bp
  • A to G, chromosome 4 at 86,811,450 bp
  • A to G, chromosome 4 at 98,736,618 bp
  • A to T, chromosome 4 at 115,089,108 bp
  • T to A, chromosome 5 at 72,666,855 bp
  • T to C, chromosome 5 at 76,153,572 bp
  • C to A, chromosome 5 at 77,282,484 bp
  • T to C, chromosome 5 at 96,636,776 bp
  • G to A, chromosome 5 at 120,817,772 bp
  • T to C, chromosome 6 at 42,593,930 bp
  • C to A, chromosome 6 at 70,117,606 bp
  • T to G, chromosome 6 at 70,117,607 bp
  • C to T, chromosome 6 at 97,120,178 bp
  • A to G, chromosome 7 at 27,738,405 bp
  • A to C, chromosome 7 at 86,801,827 bp
  • ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA to ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA, chromosome 7 at 142,156,529 bp
  • C to T, chromosome 8 at 4,216,458 bp
  • T to A, chromosome 8 at 11,399,739 bp
  • T to A, chromosome 8 at 122,360,657 bp
  • A to T, chromosome 8 at 129,220,021 bp
  • T to G, chromosome 9 at 32,322,176 bp
  • T to C, chromosome 9 at 40,333,563 bp
  • T to C, chromosome 9 at 51,073,873 bp
  • G to A, chromosome 10 at 28,781,877 bp
  • G to A, chromosome 10 at 80,173,129 bp
  • T to C, chromosome 10 at 100,589,211 bp
  • G to A, chromosome 11 at 67,207,459 bp
  • T to A, chromosome 11 at 117,834,773 bp
  • T to C, chromosome 11 at 119,424,198 bp
  • T to C, chromosome 11 at 120,093,817 bp
  • A to C, chromosome 11 at 120,544,679 bp
  • T to C, chromosome 11 at 121,160,880 bp
  • G to A, chromosome 12 at 54,975,308 bp
  • A to G, chromosome 12 at 105,742,276 bp
  • A to C, chromosome 13 at 19,677,883 bp
  • G to A, chromosome 13 at 43,406,831 bp
  • A to T, chromosome 13 at 93,663,271 bp
  • A to G, chromosome 14 at 14,846,621 bp
  • A to G, chromosome 14 at 44,586,402 bp
  • T to A, chromosome 14 at 99,107,316 bp
  • T to C, chromosome 16 at 21,995,339 bp
  • A to G, chromosome 16 at 44,789,612 bp
  • C to A, chromosome 17 at 42,503,188 bp
  • T to A, chromosome 18 at 35,716,804 bp
  • T to C, chromosome 18 at 37,743,648 bp
  • T to A, chromosome 18 at 65,814,892 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • G to A, chromosome Y at 725,464 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7185 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045237-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.