Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7185Btlr/Mmmh
Stock Number:
045237-MU
Citation ID:
RRID:MMRRC_045237-MU
Other Names:
R7185 (G1)
Major Collection:

Strain Information

Rest
Name: RE1-silencing transcription factor
Synonyms: 2610008J04Rik, NRSF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19712
HGNC: HGNC:9966
Homologene: 4099
Pdzk1ip1
Name: PDZK1 interacting protein 1
Synonyms: 0610007F13Rik, 2700030M23Rik, Map17
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67182
Homologene: 4213
Srd5a3
Name: steroid 5 alpha-reductase 3
Synonyms: D730040M03Rik, 1110025P14Rik, Srd5a2l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57357
Homologene: 41385
Kcnj5
Name: potassium inwardly-rectifying channel, subfamily J, member 5
Synonyms: Kir3.4, GIRK4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16521
VEGA: 9
HGNC: HGNC:6266
Homologene: 20248
Xpa
Name: xeroderma pigmentosum, complementation group A
Synonyms: Xpac
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22590
Homologene: 37298
Pibf1
Name: progesterone immunomodulatory binding factor 1
Synonyms: 1700017E21Rik, 4933438D16Rik, 4933439E17Rik, 4930513H15Rik, D14Ertd581e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52023
VEGA: 14
Homologene: 4628
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Dennd4c
Name: DENN domain containing 4C
Synonyms: 1700065A05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329877
Homologene: 23057
Hspa5
Name: heat shock protein 5
Synonyms: Hsce70, Bip, Grp78, Sez7, D2Wsu141e, D2Wsu17e, 78kDa, mBiP, XAP-1 antigen, baffled
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14828
HGNC: HGNC:5238
Homologene: 3908
Cenpf
Name: centromere protein F
Synonyms: 6530404A22Rik, Lek1, mitosin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108000
HGNC: HGNC:1857
Homologene: 22969
Rlig1
Name: RNA 5'-phosphate and 3'-OH ligase 1
Synonyms: 4930430F08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68281
VEGA: 10
Homologene: 18409
Gpatch2
Name: G patch domain containing 2
Synonyms: 5830436K05Rik, Gpatc2, 5830433G22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67769
Homologene: 9976
Layn
Name: layilin
Synonyms: LOC244864, E030012M19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244864
VEGA: 9
Homologene: 18716
Zfp335
Name: zinc finger protein 335
Synonyms: 1810045J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329559
Homologene: 11129
Themis
Name: thymocyte selection associated
Synonyms: E430004N04Rik, Tsepa, Gasp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 210757
Homologene: 72287
Ak7
Name: adenylate kinase 7
Synonyms: 4930502N02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78801
VEGA: 12
Homologene: 14268
Zfp451
Name: zinc finger protein 451
Synonyms: Kiaa0576-hp, 4933435G09Rik, 4930515K21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98403
Homologene: 9188
Cd200r1
Name: CD200 receptor 1
Synonyms: OX2R, CD200R, Mox2r
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 57781
Homologene: 10957
Zfp60
Name: zinc finger protein 60
Synonyms: Mfg-3, Mfg3, 6330516O17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22718
Homologene: 137228
Zfy1
Name: zinc finger protein 1, Y-linked
Synonyms: Zfy-1
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22767
Homologene: 56456
Baz1a
Name: bromodomain adjacent to zinc finger domain 1A
Synonyms: Gtl5, Wcrf180, Acf1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217578
HGNC: HGNC:960
Homologene: 45654
Tepsin
Name: TEPSIN, adaptor related protein complex 4 accessory protein
Synonyms: 2410002I01Rik, Enthd2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78777
Homologene: 35359
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215690
Homologene: 10719
L1td1
Name: LINE-1 type transposase domain containing 1
Synonyms: ECAT11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381591
Homologene: 135709
B3gat2
Name: beta-1,3-glucuronyltransferase 2
Synonyms: GlcAT-S
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 280645
HGNC: HGNC:922
Homologene: 50574
Ddr2
Name: discoidin domain receptor family, member 2
Synonyms: Ntrkr3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18214
HGNC: HGNC:2731
Homologene: 68505
Nek10
Name: NIMA (never in mitosis gene a)- related kinase 10
Synonyms: LOC238944
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 674895
Homologene: 130947
Scn7a
Name: sodium channel, voltage-gated, type VII, alpha
Synonyms: Nav2.3, NaG, Nav2, 1110034K09Rik, Scn6a, Nax
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20272
Homologene: 55706
Liph
Name: lipase, member H
Synonyms: PLA1B, mPA-PLA1, C130037N08Rik, Lpdlr, D16Wsu119e, LPDLR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239759
VEGA: 16
Homologene: 71802
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 672511
Homologene: 45439
Eogt
Name: EGF domain specific O-linked N-acetylglucosamine transferase
Synonyms: A130022J15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101351
Homologene: 65276
Rb1cc1
Name: RB1-inducible coiled-coil 1
Synonyms: LaXp180, 2900055E04Rik, Cc1, 5930404L04Rik, Fip200
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12421
Homologene: 7659
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Ptchd4
Name: patched domain containing 4
Synonyms: 3110082D06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627626
VEGA: 17
Homologene: 78322
Gramd1b
Name: GRAM domain containing 1B
Synonyms: A930008A22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235283
Homologene: 18223
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f2, Myhs-f, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Vmn2r77
Name: vomeronasal 2, receptor 77
Synonyms: EG546983
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546983
Homologene: 115466
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Col4a2
Name: collagen, type IV, alpha 2
Synonyms: Col4a-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12827
HGNC: HGNC:2203
Homologene: 1390
Tcaf3
Name: TRPM8 channel-associated factor 3
Synonyms: Eapa2, Fam115e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 403088
Homologene: 74374
Nme8
Name: NME/NM23 family member 8
Synonyms: 1700056P15Rik, Sptrx-2, Txndc3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73412
Homologene: 9593
Uts2r
Name: urotensin 2 receptor
Synonyms: urotensin II receptor, UTR2, Gpr14
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217369
HGNC: HGNC:4468
Homologene: 10345
Mcrip1
Name: MAPK regulated corepressor interacting protein 1
Synonyms: BC003940, Fam195b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192173
Homologene: 19571
Afmid
Name: arylformamidase
Synonyms: Kf, formylkynureninase, formylase, kynurenine formamidase, 9030621K19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71562
Homologene: 41731
Or5w15
Name: olfactory receptor family 5 subfamily W member 15
Synonyms: GA_x6K02T2Q125-49242149-49241214, MOR177-8, Olfr1138
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258632
Homologene: 74082
Prr36
Name: proline rich 36
Synonyms: BC068157
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73072
Homologene: 136398
Ecscr
Name: endothelial cell surface expressed chemotaxis and apoptosis regulator
Synonyms: 1110006O17Rik, ARIA
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 68545
Homologene: 86811
Trhr2
Name: thyrotropin releasing hormone receptor 2
Synonyms: TRH-R2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170732
Homologene: 44052
Qsox2
Name: quiescin Q6 sulfhydryl oxidase 2
Synonyms: QSOX2, Qscn6l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227638
Homologene: 65608
Or13j1
Name: olfactory receptor family 13 subfamily J member 1
Synonyms: mOR17, MOR262-4, GA_x6K02T2N78B-16230286-16231224, Olfr71
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56015
Homologene: 10460
Cdc14a
Name: CDC14 cell division cycle 14A
Synonyms: CDC14A2, CDC14a1, Cdc14, A830059A17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229776
HGNC: HGNC:1718
Homologene: 75343
Nol7
Name: nucleolar protein 7
Synonyms: 5730556I21Rik, RARG-1, NOP27, 2210008F15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70078
VEGA: 13
Homologene: 49451
Nipal1
Name: NIPA-like domain containing 1
Synonyms: 3830408G10Rik, Npal1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70701
Homologene: 28165
Bhmt2
Name: betaine-homocysteine methyltransferase 2
Synonyms: D13Ucla2, C81077
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 64918
HGNC: HGNC:1048
Homologene: 49496
Sec11c
Name: SEC11 homolog C, signal peptidase complex subunit
Synonyms: 1810029G24Rik, Sec11l3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66286
Homologene: 8624
Igkv8-30
Name: immunoglobulin kappa chain variable 8-30
Synonyms: ENSMUSG00000073025, Gm10883
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 384419
HGNC: HGNC:5834
Or4f56
Name: olfactory receptor family 4 subfamily F member 56
Synonyms: GA_x6K02T2Q125-72930843-72929905, MOR245-8, Olfr1305
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258396
Homologene: 74056
Spo11
Name: SPO11 initiator of meiotic double stranded breaks
Synonyms: Spo11b, Spo11a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26972
Homologene: 6059
Pcdhgb6
Name: protocadherin gamma subfamily B, 6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93703
HGNC: HGNC:8713
Homologene: 49573
Oas1b
Name: 2'-5' oligoadenylate synthetase 1B
Synonyms: Mmu-L1, Oias-2, Oias2, Flavivirus resistance, Flv, Wnv, L1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23961
HGNC: HGNC:8086
Fam174c
Name: family with sequence similarity 174, member C
Synonyms: 1600002K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69770
Homologene: 78582
Krtap5-22
Name: keratin associated protein 5-22
Synonyms: Krtap5-22, Gm29735
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101055862
Gm8247
Name: predicted gene 8247
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 102636873
Homologene: 128452
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 6,238,383 bp
  • A to C, chromosome 1 at 23,763,191 bp
  • A to T, chromosome 1 at 33,769,893 bp
  • T to C, chromosome 1 at 135,471,008 bp
  • C to A, chromosome 1 at 169,987,054 bp
  • T to C, chromosome 1 at 187,226,197 bp
  • A to G, chromosome 1 at 189,653,489 bp
  • A to G, chromosome 2 at 26,220,706 bp
  • T to C, chromosome 2 at 34,775,126 bp
  • C to T, chromosome 2 at 40,801,512 bp
  • T to A, chromosome 2 at 66,687,795 bp
  • A to G, chromosome 2 at 87,738,145 bp
  • T to G, chromosome 2 at 111,873,822 bp
  • A to G, chromosome 2 at 164,893,244 bp
  • T to A, chromosome 2 at 172,982,192 bp
  • T to C, chromosome 3 at 116,294,027 bp
  • A to G, chromosome 4 at 43,706,082 bp
  • G to T, chromosome 4 at 46,183,078 bp
  • A to G, chromosome 4 at 86,811,450 bp
  • A to G, chromosome 4 at 98,736,618 bp
  • A to T, chromosome 4 at 115,089,108 bp
  • T to A, chromosome 5 at 72,666,855 bp
  • T to C, chromosome 5 at 76,153,572 bp
  • C to A, chromosome 5 at 77,282,484 bp
  • T to C, chromosome 5 at 96,636,776 bp
  • G to A, chromosome 5 at 120,817,772 bp
  • T to C, chromosome 6 at 42,593,930 bp
  • C to A, chromosome 6 at 70,117,606 bp
  • T to G, chromosome 6 at 70,117,607 bp
  • C to T, chromosome 6 at 97,120,178 bp
  • A to G, chromosome 7 at 27,738,405 bp
  • A to C, chromosome 7 at 86,801,827 bp
  • ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA to ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA, chromosome 7 at 142,156,529 bp
  • C to T, chromosome 8 at 4,216,458 bp
  • T to A, chromosome 8 at 11,399,739 bp
  • T to A, chromosome 8 at 122,360,657 bp
  • A to T, chromosome 8 at 129,220,021 bp
  • T to G, chromosome 9 at 32,322,176 bp
  • T to C, chromosome 9 at 40,333,563 bp
  • T to C, chromosome 9 at 51,073,873 bp
  • G to A, chromosome 10 at 28,781,877 bp
  • G to A, chromosome 10 at 80,173,129 bp
  • T to C, chromosome 10 at 100,589,211 bp
  • G to A, chromosome 11 at 67,207,459 bp
  • T to A, chromosome 11 at 117,834,773 bp
  • T to C, chromosome 11 at 119,424,198 bp
  • T to C, chromosome 11 at 120,093,817 bp
  • A to C, chromosome 11 at 120,544,679 bp
  • T to C, chromosome 11 at 121,160,880 bp
  • G to A, chromosome 12 at 54,975,308 bp
  • A to G, chromosome 12 at 105,742,276 bp
  • A to C, chromosome 13 at 19,677,883 bp
  • G to A, chromosome 13 at 43,406,831 bp
  • A to T, chromosome 13 at 93,663,271 bp
  • A to G, chromosome 14 at 14,846,621 bp
  • A to G, chromosome 14 at 44,586,402 bp
  • T to A, chromosome 14 at 99,107,316 bp
  • T to C, chromosome 16 at 21,995,339 bp
  • A to G, chromosome 16 at 44,789,612 bp
  • C to A, chromosome 17 at 42,503,188 bp
  • T to A, chromosome 18 at 35,716,804 bp
  • T to C, chromosome 18 at 37,743,648 bp
  • T to A, chromosome 18 at 65,814,892 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • G to A, chromosome Y at 725,464 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7185 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045237-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.