Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7050Btlr/Mmmh
Stock Number:
045241-MU
Citation ID:
RRID:MMRRC_045241-MU
Other Names:
R7050 (G1)
Major Collection:

Strain Information

Npy1r
Name: neuropeptide Y receptor Y1
Synonyms: Y1-R, Npyr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18166
HGNC: HGNC:7956
Homologene: 700
Tbx21
Name: T-box 21
Synonyms: Tblym, TBT1, T-bet, Tbet
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57765
Homologene: 8353
Uba2
Name: ubiquitin-like modifier activating enzyme 2
Synonyms: Sumo-1 activating enzyme subunit 2, UBA2, anthracycline-associated resistance, Arx, SAE2, Uble1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50995
Homologene: 4018
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Cabin1
Name: calcineurin binding protein 1
Synonyms: Ppp3in, Cain, A330070M20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 104248
VEGA: 10
Homologene: 49307
Rev1
Name: REV1, DNA directed polymerase
Synonyms: REV1, 1110027I23Rik, Rev1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56210
Homologene: 32309
Mms19
Name: MMS19 cytosolic iron-sulfur assembly component
Synonyms: 2610042O15Rik, Mms19, C86341, Mms19l
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72199
Homologene: 41480
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 38,054,271 bp
  • A to T, chromosome 1 at 52,490,735 bp
  • A to G, chromosome 1 at 66,550,908 bp
  • T to C, chromosome 1 at 162,963,904 bp
  • A to T, chromosome 2 at 52,222,876 bp
  • A to G, chromosome 2 at 102,814,137 bp
  • T to C, chromosome 2 at 129,027,971 bp
  • G to A, chromosome 2 at 155,506,375 bp
  • T to C, chromosome 3 at 79,506,270 bp
  • A to G, chromosome 3 at 88,098,913 bp
  • A to T, chromosome 3 at 107,300,832 bp
  • T to C, chromosome 3 at 133,133,627 bp
  • A to T, chromosome 4 at 62,191,671 bp
  • T to C, chromosome 4 at 122,997,020 bp
  • A to G, chromosome 4 at 154,081,442 bp
  • G to T, chromosome 5 at 75,950,120 bp
  • A to G, chromosome 5 at 109,054,791 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • G to A, chromosome 5 at 140,666,091 bp
  • G to A, chromosome 5 at 145,244,735 bp
  • T to A, chromosome 6 at 42,817,570 bp
  • A to T, chromosome 6 at 89,933,721 bp
  • T to A, chromosome 6 at 141,547,926 bp
  • G to A, chromosome 7 at 34,146,262 bp
  • G to T, chromosome 7 at 127,944,765 bp
  • A to G, chromosome 8 at 66,704,540 bp
  • A to T, chromosome 9 at 21,592,178 bp
  • A to G, chromosome 9 at 58,157,717 bp
  • G to A, chromosome 9 at 110,628,720 bp
  • A to T, chromosome 9 at 123,598,543 bp
  • T to A, chromosome 10 at 50,840,350 bp
  • G to T, chromosome 10 at 75,713,542 bp
  • C to A, chromosome 10 at 77,781,980 bp
  • A to G, chromosome 11 at 70,612,332 bp
  • C to T, chromosome 11 at 88,981,188 bp
  • T to G, chromosome 11 at 97,114,770 bp
  • G to A, chromosome 11 at 109,973,718 bp
  • C to A, chromosome 12 at 70,219,622 bp
  • T to C, chromosome 12 at 104,341,144 bp
  • T to C, chromosome 13 at 54,796,063 bp
  • C to T, chromosome 13 at 100,315,499 bp
  • T to C, chromosome 15 at 4,516,718 bp
  • T to G, chromosome 15 at 76,854,296 bp
  • A to T, chromosome 16 at 35,303,700 bp
  • A to T, chromosome 16 at 93,690,394 bp
  • A to G, chromosome 17 at 46,961,602 bp
  • T to A, chromosome 17 at 83,215,644 bp
  • A to G, chromosome 19 at 41,950,746 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7050 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045241-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.