Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7050Btlr/Mmmh
Stock Number:
045241-MU
Citation ID:
RRID:MMRRC_045241-MU
Other Names:
R7050 (G1)
Major Collection:

Strain Information

Npy1r
Name: neuropeptide Y receptor Y1
Synonyms: Y1-R, Npyr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18166
HGNC: HGNC:7956
Homologene: 700
Tbx21
Name: T-box 21
Synonyms: Tblym, TBT1, T-bet, Tbet
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57765
Homologene: 8353
Uba2
Name: ubiquitin-like modifier activating enzyme 2
Synonyms: Sumo-1 activating enzyme subunit 2, UBA2, anthracycline-associated resistance, Arx, SAE2, Uble1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50995
Homologene: 4018
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Cabin1
Name: calcineurin binding protein 1
Synonyms: Ppp3in, Cain, A330070M20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 104248
VEGA: 10
Homologene: 49307
Rev1
Name: REV1, DNA directed polymerase
Synonyms: REV1, 1110027I23Rik, Rev1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56210
Homologene: 32309
Mms19
Name: MMS19 cytosolic iron-sulfur assembly component
Synonyms: Mms19, 2610042O15Rik, C86341, Mms19l
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72199
Homologene: 41480
Iqgap3
Name: IQ motif containing GTPase activating protein 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 404710
Homologene: 26400
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235627
Homologene: 86422
Zfp37
Name: zinc finger protein 37
Synonyms: Tzn, Zfp-37
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22696
Homologene: 40682
Ubr2
Name: ubiquitin protein ligase E3 component n-recognin 2
Synonyms: 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224826
VEGA: 17
Homologene: 26151
Zfp655
Name: zinc finger protein 655
Synonyms: 9030409O18Rik, 2700038I16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72611
Homologene: 12473
Slc16a4
Name: solute carrier family 16 (monocarboxylic acid transporters), member 4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229699
Homologene: 74529
Trp73
Name: transformation related protein 73
Synonyms: p73, TAp73, deltaNp73
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22062
Homologene: 3960
Zfp251
Name: zinc finger protein 251
Synonyms: 9130001M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71591
VEGA: 15
Homologene: 87789
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Vinac1
Name: vinculin/alpha-catenin family member 1
Synonyms: Gm14025
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668894
Homologene: 86340
Mink1
Name: misshapen-like kinase 1 (zebrafish)
Synonyms: Misshapen/NIKs-related kinase, MINK, Ysk2, Map4k6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50932
Homologene: 56762
Ggt7
Name: gamma-glutamyltransferase 7
Synonyms: 6330563L03Rik, 1110017C11Rik, Ggtl3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 207182
HGNC: HGNC:4259
Homologene: 70866
Naip6
Name: NLR family, apoptosis inhibitory protein 6
Synonyms: Naip-rs4A, Naip-rs4, Birc1f
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17952
HGNC: HGNC:7634
Homologene: 113589
Arhgef38
Name: Rho guanine nucleotide exchange factor 38
Synonyms: 9130221D24Rik, D630013G24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77669
Homologene: 137396
Adcy5
Name: adenylate cyclase 5
Synonyms: AC5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224129
VEGA: 16
HGNC: HGNC:236
Homologene: 11213
Abca8b
Name: ATP-binding cassette, sub-family A member 8b
Synonyms: Abca8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27404
HGNC: HGNC:38
Homologene: 56029
Yipf2
Name: Yip1 domain family, member 2
Synonyms: 1300010K09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74766
VEGA: 9
Homologene: 23430
Pygl
Name: liver glycogen phosphorylase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110095
HGNC: HGNC:9725
Homologene: 84371
Slco1c1
Name: solute carrier organic anion transporter family, member 1c1
Synonyms: OATP-F, Slc21a14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58807
Homologene: 23008
Prss36
Name: serine protease 36
Synonyms: polyserase-2, C330007D15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77613
Homologene: 18303
Coil
Name: coilin
Synonyms: p80-coilin, Cln80
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12812
HGNC: HGNC:2184
Homologene: 3413
Vmn1r45
Name: vomeronasal 1 receptor 45
Synonyms: V1r2, V1ra2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22297
Homologene: 130651
Kdr
Name: kinase insert domain protein receptor
Synonyms: VEGF receptor-2, VEGFR-2, vascular endothelial growth factor receptor- 2, VEGFR2, Flk-1, Flk1, orv
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16542
HGNC: HGNC:6307
Homologene: 55639
Vmn2r11
Name: vomeronasal 2, receptor 11
Synonyms: EG384219
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384219
Homologene: 129606
Iqce
Name: IQ motif containing E
Synonyms: 1700028P05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74239
Homologene: 49912
Fnip2
Name: folliculin interacting protein 2
Synonyms: D630023B12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329679
Homologene: 46417
Pkdcc
Name: protein kinase domain containing, cytoplasmic
Synonyms: ESTM17, Vlk, MAd1, Adtk1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106522
Homologene: 18932
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Or2q1
Name: olfactory receptor family 2 subfamily Q member 1
Synonyms: GA_x6K02T2P3E9-4742413-4741481, MOR257-3, Olfr450
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258437
Homologene: 51720
Nab1
Name: Ngfi-A binding protein 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17936
HGNC: HGNC:7626
Homologene: 4352
Fmo3
Name: flavin containing monooxygenase 3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14262
HGNC: HGNC:3771
Homologene: 128199
Plcxd3
Name: phosphatidylinositol-specific phospholipase C, X domain containing 3
Synonyms: B130016O10Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239318
Homologene: 45574
Slc6a20b
Name: solute carrier family 6 (neurotransmitter transporter), member 20B
Synonyms: XT3, Xtrp3, Sit1, Slc6a20
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22599
Homologene: 130652
Tspan17
Name: tetraspanin 17
Synonyms: 2210021G21Rik, Fbxo23, Tm4sf17
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74257
Homologene: 41762
Serpina3k
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3K
Synonyms: contrapsin, Spi-2, D12Rp54, RP54, Spi2, MMSpi2, MMCM2, alpha-1 antiproteinase, 1300001I07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20714
HGNC: HGNC:16
Homologene: 111129
Islr
Name: immunoglobulin superfamily containing leucine-rich repeat
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 26968
VEGA: 9
HGNC: HGNC:6133
Homologene: 4050
Mycl
Name: v-myc avian myelocytomatosis viral oncogene lung carcinoma derived
Synonyms: Lmyc-1, Lmyc1, L-myc, bHLHe38, Mycl1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16918
Homologene: 3921
Cbr3
Name: carbonyl reductase 3
Synonyms: 1110001J05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 109857
HGNC: HGNC:1549
Homologene: 20332
Krtap10-23
Name: keratin associated protein 10-23
Synonyms: Gm3250
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100041281
VEGA: 10
Homologene: 115744
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 38,054,271 bp
  • A to T, chromosome 1 at 52,490,735 bp
  • A to G, chromosome 1 at 66,550,908 bp
  • T to C, chromosome 1 at 162,963,904 bp
  • A to T, chromosome 2 at 52,222,876 bp
  • A to G, chromosome 2 at 102,814,137 bp
  • T to C, chromosome 2 at 129,027,971 bp
  • G to A, chromosome 2 at 155,506,375 bp
  • T to C, chromosome 3 at 79,506,270 bp
  • A to G, chromosome 3 at 88,098,913 bp
  • A to T, chromosome 3 at 107,300,832 bp
  • T to C, chromosome 3 at 133,133,627 bp
  • A to T, chromosome 4 at 62,191,671 bp
  • T to C, chromosome 4 at 122,997,020 bp
  • A to G, chromosome 4 at 154,081,442 bp
  • G to T, chromosome 5 at 75,950,120 bp
  • A to G, chromosome 5 at 109,054,791 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • G to A, chromosome 5 at 140,666,091 bp
  • G to A, chromosome 5 at 145,244,735 bp
  • T to A, chromosome 6 at 42,817,570 bp
  • A to T, chromosome 6 at 89,933,721 bp
  • T to A, chromosome 6 at 141,547,926 bp
  • G to A, chromosome 7 at 34,146,262 bp
  • G to T, chromosome 7 at 127,944,765 bp
  • A to G, chromosome 8 at 66,704,540 bp
  • A to T, chromosome 9 at 21,592,178 bp
  • A to G, chromosome 9 at 58,157,717 bp
  • G to A, chromosome 9 at 110,628,720 bp
  • A to T, chromosome 9 at 123,598,543 bp
  • T to A, chromosome 10 at 50,840,350 bp
  • G to T, chromosome 10 at 75,713,542 bp
  • C to A, chromosome 10 at 77,781,980 bp
  • A to G, chromosome 11 at 70,612,332 bp
  • C to T, chromosome 11 at 88,981,188 bp
  • T to G, chromosome 11 at 97,114,770 bp
  • G to A, chromosome 11 at 109,973,718 bp
  • C to A, chromosome 12 at 70,219,622 bp
  • T to C, chromosome 12 at 104,341,144 bp
  • T to C, chromosome 13 at 54,796,063 bp
  • C to T, chromosome 13 at 100,315,499 bp
  • T to C, chromosome 15 at 4,516,718 bp
  • T to G, chromosome 15 at 76,854,296 bp
  • A to T, chromosome 16 at 35,303,700 bp
  • A to T, chromosome 16 at 93,690,394 bp
  • A to G, chromosome 17 at 46,961,602 bp
  • T to A, chromosome 17 at 83,215,644 bp
  • A to G, chromosome 19 at 41,950,746 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7050 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045241-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.