Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7153Btlr/Mmmh
Stock Number:
045255-MU
Citation ID:
RRID:MMRRC_045255-MU
Other Names:
R7153 (G1)
Major Collection:

Strain Information

Prkd3
Name: protein kinase D3
Synonyms: 4930557O20Rik, 5730497N19Rik, PKD3, Prkcn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75292
HGNC: HGNC:9408
Homologene: 2055
Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Lefty1
Name: left right determination factor 1
Synonyms: lefty-1, Stra3, Lefty, Ebaf
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13590
HGNC: HGNC:6552
Homologene: 49231
Tjp2
Name: tight junction protein 2
Synonyms: ZO-2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21873
VEGA: 19
Homologene: 3541
Arhgap39
Name: Rho GTPase activating protein 39
Synonyms: D15Wsu169e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223666
Homologene: 27825
Kpna4
Name: karyopherin subunit alpha 4
Synonyms: IPOA3, 1110058D08Rik, importin alpha 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16649
HGNC: HGNC:6397
Homologene: 20521
Col6a1
Name: collagen, type VI, alpha 1
Synonyms: Col6a-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12833
HGNC: HGNC:2211
Homologene: 1391
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 46,126,804 bp
  • T to C, chromosome 1 at 58,250,219 bp
  • T to A, chromosome 1 at 180,906,682 bp
  • T to A, chromosome 1 at 180,937,767 bp
  • C to A, chromosome 1 at 188,728,484 bp
  • T to C, chromosome 2 at 21,212,953 bp
  • C to T, chromosome 2 at 24,014,341 bp
  • A to T, chromosome 2 at 37,787,408 bp
  • T to A, chromosome 2 at 76,778,504 bp
  • T to C, chromosome 2 at 76,945,316 bp
  • C to T, chromosome 2 at 84,666,428 bp
  • A to C, chromosome 2 at 88,412,118 bp
  • A to T, chromosome 2 at 111,335,901 bp
  • A to G, chromosome 2 at 128,736,649 bp
  • T to C, chromosome 2 at 152,485,920 bp
  • T to C, chromosome 2 at 164,014,060 bp
  • A to T, chromosome 2 at 181,231,285 bp
  • A to G, chromosome 3 at 69,089,798 bp
  • A to G, chromosome 3 at 123,112,404 bp
  • A to T, chromosome 4 at 72,139,061 bp
  • C to T, chromosome 4 at 86,576,016 bp
  • A to T, chromosome 4 at 106,492,033 bp
  • T to C, chromosome 4 at 118,231,543 bp
  • G to T, chromosome 4 at 149,161,678 bp
  • T to C, chromosome 6 at 29,499,015 bp
  • C to T, chromosome 6 at 57,233,866 bp
  • A to G, chromosome 6 at 113,678,709 bp
  • A to T, chromosome 6 at 120,214,968 bp
  • A to G, chromosome 6 at 125,992,943 bp
  • A to G, chromosome 6 at 143,019,409 bp
  • T to A, chromosome 7 at 3,159,513 bp
  • A to G, chromosome 7 at 85,565,054 bp
  • A to G, chromosome 7 at 105,640,880 bp
  • T to C, chromosome 7 at 116,342,252 bp
  • T to C, chromosome 7 at 140,001,036 bp
  • A to T, chromosome 8 at 61,988,108 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • A to T, chromosome 8 at 123,316,425 bp
  • T to C, chromosome 9 at 40,148,368 bp
  • T to C, chromosome 9 at 58,363,093 bp
  • T to A, chromosome 10 at 43,964,666 bp
  • T to C, chromosome 10 at 49,535,367 bp
  • C to T, chromosome 10 at 76,710,341 bp
  • G to T, chromosome 11 at 12,254,128 bp
  • A to G, chromosome 11 at 36,024,182 bp
  • G to A, chromosome 11 at 100,105,146 bp
  • C to T, chromosome 11 at 101,740,175 bp
  • TTCCTCCTCCTCCTCTTCCTCCTCCTC to TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC, chromosome 11 at 102,480,188 bp
  • A to T, chromosome 12 at 100,355,034 bp
  • G to T, chromosome 12 at 114,564,590 bp
  • A to G, chromosome 12 at 116,346,508 bp
  • T to G, chromosome 14 at 31,160,584 bp
  • T to C, chromosome 14 at 53,622,161 bp
  • T to C, chromosome 14 at 54,436,251 bp
  • T to A, chromosome 14 at 56,950,202 bp
  • T to C, chromosome 14 at 76,095,011 bp
  • T to A, chromosome 15 at 28,365,522 bp
  • C to A, chromosome 15 at 76,765,491 bp
  • G to A, chromosome 15 at 101,865,496 bp
  • A to G, chromosome 16 at 21,766,321 bp
  • G to A, chromosome 16 at 23,966,226 bp
  • C to T, chromosome 16 at 90,948,090 bp
  • T to A, chromosome 16 at 96,173,809 bp
  • A to G, chromosome 17 at 7,801,645 bp
  • A to G, chromosome 17 at 26,187,968 bp
  • A to G, chromosome 17 at 31,162,798 bp
  • G to A, chromosome 17 at 45,585,762 bp
  • T to C, chromosome 17 at 56,614,137 bp
  • C to A, chromosome 17 at 63,060,351 bp
  • T to C, chromosome 17 at 74,447,103 bp
  • C to T, chromosome 17 at 78,966,355 bp
  • A to G, chromosome 18 at 12,213,291 bp
  • T to C, chromosome 18 at 37,011,225 bp
  • T to C, chromosome 18 at 37,669,208 bp
  • A to G, chromosome 19 at 6,958,084 bp
  • A to T, chromosome 19 at 24,101,981 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7153 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045255-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.