Strain Name:
C57BL/6J-MtgxR7179Btlr/Mmmh
Stock Number:
045269-MU
Citation ID:
RRID:MMRRC_045269-MU
Other Names:
R7179 (G1)
Major Collection:

Strain Information

Zic4
Name: zinc finger protein of the cerebellum 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22774
Homologene: 32075
Slc1a2
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms: GLT-1, Eaat2, GLT1, 1700091C19Rik, MGLT1, 2900019G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20511
Homologene: 3075
Eya1
Name: EYA transcriptional coactivator and phosphatase 1
Synonyms: bor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14048
HGNC: HGNC:3519
Homologene: 74943
Slc27a4
Name: solute carrier family 27 (fatty acid transporter), member 4
Synonyms: FATP4, fatty acid transport protein 4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26569
Homologene: 68437
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15184
Homologene: 3995
Zfp688
Name: zinc finger protein 688
Synonyms: 2810407K09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69234
Homologene: 17058
Vps54
Name: VPS54 GARP complex subunit
Synonyms: 5330404P15Rik, mSLP8, Vps54l, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Cnst
Name: consortin, connexin sorting protein
Synonyms: 9630058J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226744
Homologene: 17139
Mapkap1
Name: mitogen-activated protein kinase associated protein 1
Synonyms: D230039K05Rik, Sin1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227743
Homologene: 11473
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: 1110037D04Rik, Carmil, Lrrc16, Lrrc16a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68732
Homologene: 9757
Rrp12
Name: ribosomal RNA processing 12 homolog
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107094
VEGA: 19
Homologene: 22370
Cep104
Name: centrosomal protein 104
Synonyms: BC046331
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230967
Homologene: 44919
Mcm3
Name: minichromosome maintenance complex component 3
Synonyms: Mcmd, p1.m, P1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17215
HGNC: HGNC:6945
Homologene: 1791
Baz2a
Name: bromodomain adjacent to zinc finger domain, 2A
Synonyms: Tip5, C030005G16Rik, Walp3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 116848
VEGA: 10
HGNC: HGNC:962
Homologene: 8393
Ncor2
Name: nuclear receptor co-repressor 2
Synonyms: SMRTe, SMRT
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20602
HGNC: HGNC:7673
Homologene: 31370
Ccnk
Name: cyclin K
Synonyms: CPR4, CycK
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12454
VEGA: 12
HGNC: HGNC:1596
Homologene: 14748
Usp53
Name: ubiquitin specific peptidase 53
Synonyms: mbo, Sp6, Phxr3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99526
Homologene: 34521
Galnt5
Name: polypeptide N-acetylgalactosaminyltransferase 5
Synonyms: ppGaNTase-T5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241391
HGNC: HGNC:4127
Homologene: 8733
Lepr
Name: leptin receptor
Synonyms: OB-RGRP, Leprb, Obr, LEPROT, obese-like, obl, Modb1, leptin receptor gene-related protein
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16847
HGNC: HGNC:6554
Homologene: 1731
Chd2
Name: chromodomain helicase DNA binding protein 2
Synonyms: 5630401D06Rik, 2810040A01Rik, 2810013C04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244059
HGNC: HGNC:1917
Homologene: 37462
Syt14
Name: synaptotagmin XIV
Synonyms: B230320I09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329324
Homologene: 17719
Spg11
Name: SPG11, spatacsin vesicle trafficking associated
Synonyms: spastic paraplegia 11, 6030465E24Rik, C530005A01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214585
Homologene: 41614
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Spag9
Name: sperm associated antigen 9
Synonyms: JLP, syd1, 4733401I23Rik, JIP4, Mapk8ip4, 3110018C07Rik, 4831406C20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70834
Homologene: 2954
Zfp451
Name: zinc finger protein 451
Synonyms: Kiaa0576-hp, 4933435G09Rik, 4930515K21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98403
Homologene: 9188
Hjurp
Name: Holliday junction recognition protein
Synonyms: 6430706D22Rik, C330011F01Rik, A730008H23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381280
Homologene: 10184
Muc16
Name: mucin 16
Synonyms: 1110008I14Rik, Gm21044, LOC385009
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Prim1
Name: DNA primase, p49 subunit
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19075
HGNC: HGNC:9369
Homologene: 730
Osbpl7
Name: oxysterol binding protein-like 7
Synonyms: 4933437E18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71240
Homologene: 79672
Sec24b
Name: SEC24 homolog B, COPII coat complex component
Synonyms: SEC24
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99683
Homologene: 55968
Nbas
Name: neuroblastoma amplified sequence
Synonyms: 4933425L03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71169
VEGA: 12
Homologene: 41073
Ctnnd2
Name: catenin delta 2
Synonyms: Nprap, catenin (cadherin associated protein), delta 2, Catnd2, neurojugin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18163
VEGA: 15
HGNC: HGNC:2516
Homologene: 55574
Trpc1
Name: transient receptor potential cation channel, subfamily C, member 1
Synonyms: Trrp1, Mtrp1, Trp1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22063
Homologene: 2478
Ccr1
Name: C-C motif chemokine receptor 1
Synonyms: Cmkbr1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12768
VEGA: 9
HGNC: HGNC:1602
Homologene: 20344
Cd24a
Name: CD24a antigen
Synonyms: Ly-52, cluster of differentiation 24, HSA, heat stable antigen, nectadrin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12484
VEGA: 10
HGNC: HGNC:1645
Sycp2l
Name: synaptonemal complex protein 2-like
Synonyms: EG621792, Gm40956, LOC218175
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 637277
Homologene: 52882
Scaf1
Name: SR-related CTD-associated factor 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233208
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: 2310008C07Rik, myomaxin, mXin beta, A530024P18Rik, 2310003D02Rik, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
Scn2a
Name: sodium channel, voltage-gated, type II, alpha
Synonyms: Nav1.2, Scn2a1, A230052E19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110876
Homologene: 75001
Or5k1
Name: olfactory receptor family 5 subfamily K member 1
Synonyms: MOR184-3, GA_x54KRFPKG5P-54960233-54959268, Olfr173
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259002
Homologene: 45084
Gas2l2
Name: growth arrest-specific 2 like 2
Synonyms: OTTMUSG00000000934
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237891
Homologene: 16409
Rasal3
Name: RAS protein activator like 3
Synonyms: A430107D22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320484
Homologene: 18901
Metrnl
Name: meteorin, glial cell differentiation regulator-like
Synonyms: 9430048M07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 210029
Homologene: 16993
Rspo1
Name: R-spondin 1
Synonyms: R-spondin, Rspondin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 192199
Homologene: 52148
Col22a1
Name: collagen, type XXII, alpha 1
Synonyms: 2310067L16Rik, C80743
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69700
Homologene: 43567
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: Minimsc, Myhsf, Minmus, MyHC-IIb, MHC2B, MYH-2B, MM
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Rufy4
Name: RUN and FYVE domain containing 4
Synonyms: F930048N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 435626
Homologene: 52359
Adam6a
Name: a disintegrin and metallopeptidase domain 6A
Synonyms: Adam6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238406
HGNC: HGNC:213
Homologene: 128362
Arfgef3
Name: ARFGEF family member 3
Synonyms: B930094H20Rik, BIG3, D10Bwg1379e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215821
VEGA: 10
Homologene: 41366
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Mug1
Name: murinoglobulin 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17836
HGNC: HGNC:9750
Homologene: 136663
Fyn
Name: Fyn proto-oncogene
Synonyms: Src Kinase p59
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14360
HGNC: HGNC:4037
Homologene: 48068
Apol7c
Name: apolipoprotein L 7c
Synonyms: 2210421G13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 108956
VEGA: 15
HGNC: HGNC:619
Homologene: 40940
Bmp3
Name: bone morphogenetic protein 3
Synonyms: 9530029I04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 110075
HGNC: HGNC:1070
Homologene: 927
Tkt
Name: transketolase
Synonyms: p68
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21881
Homologene: 68154
Snx33
Name: sorting nexin 33
Synonyms: E130307J07Rik, Sh3px3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235406
VEGA: 9
Homologene: 45165
Garin4
Name: golgi associated RAB2 interactor family member 4
Synonyms: Fam71a, 4933417M04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 619288
Homologene: 77474
D3Ertd751e
Name: DNA segment, Chr 3, ERATO Doi 751, expressed
Synonyms: 2810009O15Rik, 4930415G15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73852
Homologene: 12520
Dsc2
Name: desmocollin 2
Synonyms: Dsc2a, Dsc2b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13506
HGNC: HGNC:3036
Homologene: 8397
Khnyn
Name: KH and NYN domain containing
Synonyms: 9130227C08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219094
VEGA: 14
Homologene: 23611
Prss54
Name: serine protease 54
Synonyms: 4931432M23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70993
Homologene: 19278
Pak1ip1
Name: PAK1 interacting protein 1
Synonyms: Gdpd1, 5830431I15Rik, p21-activated protein kinase-interacting protein 1, 5930415H02Rik, PIP1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68083
Homologene: 39574
Lrfn5
Name: leucine rich repeat and fibronectin type III domain containing 5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238205
Homologene: 17582
Slc25a54
Name: solute carrier family 25, member 54
Synonyms: SCaMC-1like, 4930443G12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74686
Homologene: 82464
Col25a1
Name: collagen, type XXV, alpha 1
Synonyms: 2700062B08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77018
Homologene: 57111
Mettl22
Name: methyltransferase 22, Kin17 lysine
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239706
Homologene: 16619
Prl3b1
Name: prolactin family 3, subfamily b, member 1
Synonyms: Csh2, Pl-2, Pl2, mplII, mPL-II, PL, prolactin-like
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18776
Homologene: 7476
Or14a256
Name: olfactory receptor family 14 subfamily A member 256
Synonyms: Olfr294, GA_x6K02T2NHDJ-9504525-9505532, MOR219-5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257904
Or51d1
Name: olfactory receptor family 51 subfamily D member 1
Synonyms: MOR18-3, GA_x6K02T2PBJ9-5414934-5415902, Olfr557
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258358
Homologene: 123803
Bves
Name: blood vessel epicardial substance
Synonyms: Popdc1, popeye 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 23828
VEGA: 10
HGNC: HGNC:1152
Homologene: 48497
Slc2a10
Name: solute carrier family 2 (facilitated glucose transporter), member 10
Synonyms: Glut10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170441
Homologene: 38551
Taar9
Name: trace amine-associated receptor 9
Synonyms: Tar3, Ta3, Trar3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 503558
Homologene: 65286
Fam131c
Name: family with sequence similarity 131, member C
Synonyms: LOC277743
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277743
Homologene: 18806
Flvcr2
Name: feline leukemia virus subgroup C cellular receptor 2
Synonyms: Mfsd7c, CCT
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217721
VEGA: 12
Homologene: 9840
Acot13
Name: acyl-CoA thioesterase 13
Synonyms: 0610006O17Rik, Them2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66834
Homologene: 41273
Krtap10-28
Name: keratin associated protein 10-28
Synonyms: Gm9508
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 670895
VEGA: 10
Homologene: 115744
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 14,302,852 bp
  • A to G, chromosome 1 at 20,814,857 bp
  • A to T, chromosome 1 at 33,802,570 bp
  • A to G, chromosome 1 at 74,132,876 bp
  • TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT, chromosome 1 at 88,266,278 bp
  • A to T, chromosome 1 at 179,579,382 bp
  • G to A, chromosome 1 at 191,164,021 bp
  • A to G, chromosome 1 at 192,933,263 bp
  • T to G, chromosome 2 at 29,815,652 bp
  • T to A, chromosome 2 at 34,518,700 bp
  • A to C, chromosome 2 at 57,998,609 bp
  • A to T, chromosome 2 at 65,701,979 bp
  • A to T, chromosome 2 at 67,509,833 bp
  • A to G, chromosome 2 at 102,755,945 bp
  • A to T, chromosome 2 at 122,101,789 bp
  • T to C, chromosome 2 at 165,515,349 bp
  • C to A, chromosome 3 at 41,748,708 bp
  • T to A, chromosome 3 at 109,107,257 bp
  • A to G, chromosome 3 at 122,949,710 bp
  • A to G, chromosome 3 at 129,988,946 bp
  • G to T, chromosome 3 at 130,530,119 bp
  • A to T, chromosome 4 at 101,745,659 bp
  • A to G, chromosome 4 at 125,005,038 bp
  • A to T, chromosome 4 at 141,383,017 bp
  • A to G, chromosome 4 at 153,992,867 bp
  • T to A, chromosome 5 at 98,872,763 bp
  • T to C, chromosome 5 at 125,055,783 bp
  • C to T, chromosome 6 at 85,621,369 bp
  • A to G, chromosome 6 at 121,857,420 bp
  • G to A, chromosome 7 at 45,007,743 bp
  • A to T, chromosome 7 at 73,475,420 bp
  • A to T, chromosome 7 at 86,616,366 bp
  • A to G, chromosome 7 at 102,698,270 bp
  • A to G, chromosome 7 at 127,419,312 bp
  • A to T, chromosome 8 at 95,565,571 bp
  • T to C, chromosome 9 at 18,642,008 bp
  • C to T, chromosome 9 at 56,925,867 bp
  • A to G, chromosome 9 at 91,379,121 bp
  • A to T, chromosome 9 at 95,721,144 bp
  • A to T, chromosome 9 at 123,964,052 bp
  • A to T, chromosome 10 at 18,599,267 bp
  • A to T, chromosome 10 at 24,108,984 bp
  • A to G, chromosome 10 at 39,532,124 bp
  • G to A, chromosome 10 at 43,582,640 bp
  • A to G, chromosome 10 at 45,354,817 bp
  • G to T, chromosome 10 at 77,696,636 bp
  • A to G, chromosome 10 at 128,015,976 bp
  • C to T, chromosome 10 at 128,124,457 bp
  • T to G, chromosome 11 at 21,298,791 bp
  • A to G, chromosome 11 at 67,244,724 bp
  • G to A, chromosome 11 at 83,422,462 bp
  • A to T, chromosome 11 at 94,089,432 bp
  • G to A, chromosome 11 at 97,050,836 bp
  • G to T, chromosome 11 at 102,204,559 bp
  • G to A, chromosome 11 at 121,715,908 bp
  • A to G, chromosome 12 at 13,405,397 bp
  • G to A, chromosome 12 at 61,843,982 bp
  • T to C, chromosome 12 at 85,747,191 bp
  • T to A, chromosome 12 at 108,187,258 bp
  • A to G, chromosome 12 at 113,545,671 bp
  • A to G, chromosome 13 at 24,020,069 bp
  • A to T, chromosome 13 at 24,818,171 bp
  • G to T, chromosome 13 at 27,243,844 bp
  • A to G, chromosome 13 at 41,009,542 bp
  • A to G, chromosome 13 at 41,129,782 bp
  • C to T, chromosome 14 at 30,559,858 bp
  • C to T, chromosome 14 at 55,894,354 bp
  • T to C, chromosome 15 at 30,683,364 bp
  • A to G, chromosome 15 at 71,933,413 bp
  • T to C, chromosome 15 at 77,525,643 bp
  • A to G, chromosome 16 at 8,478,060 bp
  • T to A, chromosome 16 at 58,796,887 bp
  • G to A, chromosome 17 at 32,392,417 bp
  • G to A, chromosome 18 at 10,544,576 bp
  • C to T, chromosome 18 at 20,035,275 bp
  • T to A, chromosome 19 at 41,883,778 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7179 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045269-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.