Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7201Btlr/Mmmh
Stock Number:
045279-MU
Citation ID:
RRID:MMRRC_045279-MU
Other Names:
R7201 (G1)
Major Collection:

Strain Information

Zfp143
Name: zinc finger protein 143
Synonyms: D7Ertd805e, pHZ-1, KRAB14, Zfp79, Zfp80-rs1, Staf
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20841
Homologene: 56444
Atg7
Name: autophagy related 7
Synonyms: 1810013K23Rik, Apg7l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74244
Homologene: 4662
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Slc6a2
Name: solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
Synonyms: Slc6a5, NE transporter, NET, norepinephrine transporter
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20538
Homologene: 816
Ly6a
Name: lymphocyte antigen 6 family member A
Synonyms: Sca-1, TAP, Ly-6A/E, Ly-6E.1, Ly-6A.2, Sca1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110454
Homologene: 113718
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 21,402,875 bp
  • G to T, chromosome 1 at 60,763,173 bp
  • A to T, chromosome 1 at 92,886,824 bp
  • A to G, chromosome 1 at 134,390,468 bp
  • A to G, chromosome 1 at 155,241,934 bp
  • G to T, chromosome 1 at 170,963,397 bp
  • A to G, chromosome 1 at 185,267,191 bp
  • A to G, chromosome 1 at 188,874,754 bp
  • T to C, chromosome 2 at 53,073,654 bp
  • T to C, chromosome 2 at 79,333,590 bp
  • A to G, chromosome 2 at 83,878,230 bp
  • T to C, chromosome 2 at 125,096,162 bp
  • AGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG to AGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG, chromosome 2 at 180,595,094 bp
  • C to T, chromosome 3 at 87,252,627 bp
  • C to T, chromosome 3 at 94,702,357 bp
  • C to A, chromosome 3 at 114,090,157 bp
  • T to C, chromosome 3 at 131,599,926 bp
  • A to T, chromosome 3 at 135,411,213 bp
  • G to A, chromosome 4 at 9,474,917 bp
  • A to T, chromosome 4 at 47,307,752 bp
  • G to C, chromosome 4 at 61,673,336 bp
  • T to A, chromosome 4 at 89,692,171 bp
  • T to A, chromosome 4 at 101,838,141 bp
  • G to A, chromosome 4 at 155,470,321 bp
  • T to A, chromosome 5 at 21,737,179 bp
  • A to G, chromosome 5 at 23,507,628 bp
  • A to G, chromosome 5 at 48,237,285 bp
  • G to T, chromosome 5 at 73,629,897 bp
  • T to C, chromosome 5 at 81,724,222 bp
  • C to T, chromosome 5 at 112,715,459 bp
  • A to T, chromosome 5 at 137,736,262 bp
  • A to G, chromosome 5 at 143,137,798 bp
  • A to C, chromosome 5 at 145,991,447 bp
  • T to A, chromosome 5 at 146,003,058 bp
  • G to A, chromosome 6 at 8,644,015 bp
  • C to T, chromosome 6 at 43,273,232 bp
  • A to T, chromosome 6 at 85,830,895 bp
  • A to G, chromosome 6 at 114,777,057 bp
  • A to T, chromosome 6 at 129,873,343 bp
  • A to T, chromosome 6 at 136,854,549 bp
  • G to A, chromosome 7 at 17,158,238 bp
  • A to T, chromosome 7 at 23,702,158 bp
  • A to C, chromosome 7 at 27,160,319 bp
  • A to T, chromosome 7 at 28,316,788 bp
  • A to G, chromosome 7 at 80,311,089 bp
  • T to A, chromosome 7 at 102,724,485 bp
  • T to C, chromosome 7 at 110,093,080 bp
  • T to A, chromosome 7 at 113,285,142 bp
  • T to C, chromosome 8 at 13,142,991 bp
  • T to C, chromosome 8 at 92,995,672 bp
  • T to C, chromosome 9 at 21,007,338 bp
  • T to C, chromosome 9 at 31,316,306 bp
  • G to A, chromosome 9 at 37,424,330 bp
  • A to T, chromosome 9 at 86,790,146 bp
  • T to A, chromosome 9 at 88,731,586 bp
  • A to T, chromosome 9 at 108,404,775 bp
  • A to G, chromosome 10 at 23,785,231 bp
  • A to G, chromosome 10 at 23,992,460 bp
  • A to G, chromosome 10 at 79,974,078 bp
  • T to C, chromosome 10 at 82,291,627 bp
  • A to T, chromosome 10 at 89,712,512 bp
  • A to G, chromosome 11 at 51,788,252 bp
  • A to G, chromosome 11 at 61,489,172 bp
  • A to G, chromosome 11 at 73,814,341 bp
  • A to G, chromosome 11 at 84,262,474 bp
  • GAACAAGTCCACAACAA to GAACAA, chromosome 11 at 85,022,855 bp
  • A to G, chromosome 11 at 103,631,351 bp
  • T to A, chromosome 13 at 13,709,300 bp
  • T to C, chromosome 13 at 41,051,440 bp
  • G to A, chromosome 13 at 104,207,172 bp
  • T to C, chromosome 14 at 26,814,622 bp
  • A to T, chromosome 14 at 54,664,899 bp
  • T to C, chromosome 14 at 54,990,945 bp
  • A to T, chromosome 14 at 99,196,408 bp
  • T to A, chromosome 15 at 74,996,476 bp
  • A to G, chromosome 16 at 15,698,803 bp
  • A to C, chromosome 17 at 27,794,070 bp
  • A to T, chromosome 17 at 30,597,854 bp
  • G to A, chromosome 17 at 55,608,496 bp
  • C to A, chromosome 18 at 20,328,311 bp
  • A to G, chromosome 19 at 10,638,115 bp
  • T to A, chromosome 19 at 39,401,776 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7201 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045279-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.