Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7204Btlr/Mmmh
Stock Number:
045282-MU
Citation ID:
RRID:MMRRC_045282-MU
Other Names:
R7204 (G1)
Major Collection:

Strain Information

Slc12a1
Name: solute carrier family 12, member 1
Synonyms: Nkcc2, mBSC1, D630042G03Rik, urehr3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20495
Homologene: 286
Col3a1
Name: collagen, type III, alpha 1
Synonyms: Col3a-1, Tsk-2, Tsk2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12825
HGNC: HGNC:2201
Homologene: 55433
Ulk2
Name: unc-51 like kinase 2
Synonyms: Unc51.2, A830085I22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 29869
Homologene: 5891
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Nfib
Name: nuclear factor I/B
Synonyms: 6720429L07Rik, E030026I10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18028
HGNC: HGNC:7785
Homologene: 4087
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 45,322,418 bp
  • A to T, chromosome 1 at 126,026,367 bp
  • A to T, chromosome 1 at 128,338,127 bp
  • T to A, chromosome 1 at 138,117,862 bp
  • A to T, chromosome 2 at 38,039,203 bp
  • A to G, chromosome 2 at 69,472,533 bp
  • A to T, chromosome 2 at 94,362,428 bp
  • A to T, chromosome 2 at 119,328,573 bp
  • T to A, chromosome 2 at 120,904,077 bp
  • A to T, chromosome 2 at 125,200,622 bp
  • A to T, chromosome 2 at 131,191,632 bp
  • AG to A, chromosome 2 at 152,760,698 bp
  • A to T, chromosome 2 at 180,202,177 bp
  • A to G, chromosome 3 at 88,326,610 bp
  • A to T, chromosome 3 at 89,346,937 bp
  • A to G, chromosome 3 at 90,389,726 bp
  • A to G, chromosome 3 at 116,793,820 bp
  • T to A, chromosome 4 at 44,679,485 bp
  • T to C, chromosome 4 at 46,397,054 bp
  • A to G, chromosome 4 at 61,833,755 bp
  • T to C, chromosome 4 at 63,971,155 bp
  • T to C, chromosome 4 at 82,296,815 bp
  • T to C, chromosome 4 at 101,175,135 bp
  • A to G, chromosome 4 at 126,256,015 bp
  • A to T, chromosome 5 at 4,755,980 bp
  • A to G, chromosome 5 at 21,308,626 bp
  • T to G, chromosome 5 at 66,451,603 bp
  • T to C, chromosome 5 at 137,427,978 bp
  • T to G, chromosome 5 at 137,812,084 bp
  • T to C, chromosome 6 at 42,675,039 bp
  • T to A, chromosome 6 at 57,210,156 bp
  • T to C, chromosome 6 at 124,577,427 bp
  • T to A, chromosome 6 at 130,188,680 bp
  • A to T, chromosome 6 at 140,010,424 bp
  • T to C, chromosome 7 at 27,180,933 bp
  • A to T, chromosome 7 at 28,298,905 bp
  • A to T, chromosome 7 at 127,384,346 bp
  • AGGCGCAGAAACCCTGGC to AGGC, chromosome 7 at 141,634,450 bp
  • G to A, chromosome 8 at 4,311,712 bp
  • T to C, chromosome 8 at 36,146,761 bp
  • C to A, chromosome 8 at 71,479,025 bp
  • T to C, chromosome 8 at 84,004,007 bp
  • T to A, chromosome 8 at 94,491,525 bp
  • A to T, chromosome 8 at 123,286,477 bp
  • A to T, chromosome 9 at 20,285,804 bp
  • C to A, chromosome 9 at 103,432,666 bp
  • C to T, chromosome 9 at 109,100,175 bp
  • A to T, chromosome 10 at 18,646,462 bp
  • A to G, chromosome 10 at 22,067,886 bp
  • A to G, chromosome 10 at 77,085,276 bp
  • T to C, chromosome 10 at 80,810,485 bp
  • A to T, chromosome 10 at 127,068,118 bp
  • A to T, chromosome 10 at 128,643,890 bp
  • C to T, chromosome 11 at 61,783,631 bp
  • A to G, chromosome 11 at 69,029,741 bp
  • G to A, chromosome 11 at 89,041,480 bp
  • A to G, chromosome 12 at 84,106,527 bp
  • A to T, chromosome 12 at 98,771,356 bp
  • A to G, chromosome 12 at 105,742,243 bp
  • A to C, chromosome 13 at 64,210,198 bp
  • G to A, chromosome 14 at 26,778,912 bp
  • A to T, chromosome 14 at 26,781,485 bp
  • G to C, chromosome 14 at 55,872,733 bp
  • C to T, chromosome 14 at 69,847,597 bp
  • G to A, chromosome 14 at 72,474,186 bp
  • T to A, chromosome 15 at 4,094,042 bp
  • T to A, chromosome 15 at 44,523,553 bp
  • T to C, chromosome 15 at 63,825,054 bp
  • A to G, chromosome 15 at 76,698,999 bp
  • C to A, chromosome 16 at 59,558,890 bp
  • T to C, chromosome 16 at 63,652,332 bp
  • AGCTGGATGCAGTGGTGGTCAGGGTGGGTGTAGAGCCTGAGCCAGTGCTGGATACAGTGGTGGTC to AGCTGGATACAGTGGTGGTC, chromosome 17 at 35,621,213 bp
  • C to A, chromosome 17 at 74,640,108 bp
  • A to T, chromosome 18 at 37,309,239 bp
  • T to A, chromosome 19 at 12,462,894 bp
  • G to A, chromosome 19 at 38,124,103 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7204 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045282-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.