Strain Name:
C57BL/6J-MtgxR7205Btlr/Mmmh
Stock Number:
045283-MU
Citation ID:
RRID:MMRRC_045283-MU
Other Names:
R7205 (G1)
Major Collection:

Strain Information

Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: Fltn, Myhn1, NMHC II-A, E030044M24Rik, myosin IIA, Myhn-1, D0Jmb2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Bcl2l2
Name: BCL2-like 2
Synonyms: Gtrosa41, Gtrgal2, Bcl-w, bclw
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12050
Homologene: 2989
Aldh1l1
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: Fthfd, 1810048F20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107747
HGNC: HGNC:3978
Homologene: 122031
Ulk2
Name: unc-51 like kinase 2
Synonyms: Unc51.2, A830085I22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 29869
Homologene: 5891
Upf1
Name: UPF1 RNA helicase and ATPase
Synonyms: B430202H16Rik, Rent1, PNORF-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Wnk1
Name: WNK lysine deficient protein kinase 1
Synonyms: EG406236, Prkwnk1, 6430573H23Rik, Hsn2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232341
Homologene: 14253
Ambra1
Name: autophagy/beclin 1 regulator 1
Synonyms: D030051N19Rik, 2310079H06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228361
Homologene: 18204
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: 2900001A12Rik, GAC-1, ANCO-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106585
Homologene: 9059
Tut7
Name: terminal uridylyl transferase 7
Synonyms: 6030448M23Rik, Zcchc6, Tent3b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214290
VEGA: 13
Homologene: 51941
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lphn2, Lec1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99633
Homologene: 22712
Nup98
Name: nucleoporin 98
Synonyms: Nup96
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269966
HGNC: HGNC:8068
Homologene: 35472
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D7H15F37S1, jdf2, rjs, D15F32S1h
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Ints4
Name: integrator complex subunit 4
Synonyms: 2610034N24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101861
Homologene: 69427
Fip1l1
Name: factor interacting with PAPOLA and CPSF1
Synonyms: 1300019H17Rik, Rje
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66899
Homologene: 136254
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, 9330187F13Rik, 2610040L17Rik, D3Bwg1534e, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Lrrfip1
Name: leucine rich repeat (in FLII) interacting protein 1
Synonyms: FLAP (FLI LRR associated protein), Fliiap1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16978
HGNC: HGNC:6702
Homologene: 48301
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, E430018P19Rik, KMT2H, 8030453L17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Trappc10
Name: trafficking protein particle complex 10
Synonyms: b2b2613Clo, LOC380642, b2b2416Clo, B230307C21Rik, Tmem1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216131
VEGA: 10
Homologene: 37751
Oprd1
Name: opioid receptor, delta 1
Synonyms: DOR-1, DOR, mDOR, Nbor
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18386
HGNC: HGNC:8153
Homologene: 20252
Apob
Name: apolipoprotein B
Synonyms: apob-48, apob-100
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Scn10a
Name: sodium channel, voltage-gated, type X, alpha
Synonyms: Nav1.8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20264
VEGA: 9
Homologene: 21300
Grin2c
Name: glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms: NR2C, NMDAR2C, GluRepsilon3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14813
HGNC: HGNC:4587
Homologene: 647
Arhgap17
Name: Rho GTPase activating protein 17
Synonyms: WBP15, Nadrin, 5730403H17Rik, Rich1, Nadrin2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70497
Homologene: 9984
Ibsp
Name: integrin binding sialoprotein
Synonyms: bone sialoprotein, Bsp2, BSP, Bsp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15891
HGNC: HGNC:5341
Homologene: 3644
Rad1
Name: RAD1 checkpoint DNA exonuclease
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19355
HGNC: HGNC:9806
Homologene: 37695
Arhgap33
Name: Rho GTPase activating protein 33
Synonyms: Tcgap, Snx26, NOMA-GAP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233071
Homologene: 76448
Cdk12
Name: cyclin dependent kinase 12
Synonyms: Crk7, 1810022J16Rik, D11Ertd752e, Crkrs
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69131
Homologene: 128632
Nup50
Name: nucleoporin 50
Synonyms: 1700030K07Rik, Npap60
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18141
VEGA: 15
HGNC: HGNC:8065
Homologene: 5190
Ddx11
Name: DEAD/H box helicase 11
Synonyms: essa15a, DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11, 4732462I11Rik, CHL1, KRG2, CHLR1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320209
VEGA: 17
Homologene: 68973
Uxs1
Name: UDP-glucuronate decarboxylase 1
Synonyms: 1600025I13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67883
Homologene: 41609
Ptgs2
Name: prostaglandin-endoperoxide synthase 2
Synonyms: COX2, cyclooxygenase 2, cyclooxygenase-2, Tis10, PGHS-2, PHS-2, Pghs2, Cox-2, prostaglandin G/H synthase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19225
HGNC: HGNC:9605
Homologene: 31000
Grina
Name: glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
Synonyms: 1110025J15Rik, Tmbim3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66168
VEGA: 15
HGNC: HGNC:4589
Homologene: 41517
Lrp3
Name: low density lipoprotein receptor-related protein 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435965
HGNC: HGNC:6695
Homologene: 1745
Bicdl1
Name: BICD family like cargo adaptor 1
Synonyms: 2210403N09Rik, Ccdc64, BICDR-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75665
Homologene: 18013
Smad6
Name: SMAD family member 6
Synonyms: b2b390Clo, Smad 6, Madh6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17130
HGNC: HGNC:6772
Homologene: 4079
Zfp418
Name: zinc finger protein 418
Synonyms: A230102I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232854
Homologene: 119890
Muc6
Name: mucin 6, gastric
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 353328
HGNC: HGNC:7517
Homologene: 18768
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: HL19, Hdhc3, Dnahc12, HL-19, LOC380889, DHC3, Dnahc7l, 4921531P07Rik, DLP12
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Nelfe
Name: negative elongation factor complex member E, Rdbp
Synonyms: Rdbp, NELF-E
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27632
Homologene: 134736
Gm7361
Name: predicted gene 7361
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 664837
Homologene: 69402
Cdcp3
Name: CUB domain containing protein 3
Synonyms: 5430419D17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71395
Homologene: 138430
Kif17
Name: kinesin family member 17
Synonyms: N-4 kinesin, 5930435E01Rik, Kif17b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16559
Homologene: 5883
Fyco1
Name: FYVE and coiled-coil domain containing 1
Synonyms: ZFYVE7, 2810409M01Rik, Mem2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17281
Homologene: 11561
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: Mgr1, Gpr98, Mass1, VLGR1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Drc7
Name: dynein regulatory complex subunit 7
Synonyms: SRG-L, Ccdc135, LOC330830
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330830
Homologene: 12996
Abca15
Name: ATP-binding cassette, sub-family A member 15
Synonyms: 4930500I12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320631
Homologene: 87255
Vmn1r59
Name: vomeronasal 1 receptor 59
Synonyms: V1rd10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404284
Homologene: 41799
Map6
Name: microtubule-associated protein 6
Synonyms: 2810411E12Rik, F-STOP, STOP, Mtap6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17760
HGNC: HGNC:6868
Homologene: 7850
Osbp2
Name: oxysterol binding protein 2
Synonyms: 1700095P05Rik, C630001G20Rik, ORP-4, OSBPL1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74309
HGNC: HGNC:8504
Homologene: 75303
Wdr64
Name: WD repeat domain 64
Synonyms: 4930511H01Rik, 4930415O10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75820
Homologene: 51634
Pcsk6
Name: proprotein convertase subtilisin/kexin type 6
Synonyms: SPC4, PACE4, b2b2830Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18553
HGNC: HGNC:8569
Homologene: 20569
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: E230008N13Rik, LOC381522
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381522
Homologene: 117988
Golgb1
Name: golgin B1
Synonyms: Giantin, C130074L01Rik, Gm6840, F730017E11Rik, 6330407A06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224139
HGNC: HGNC:4429
Homologene: 68401
Pcdh18
Name: protocadherin 18
Synonyms: PCDH68L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73173
Homologene: 10389
Serpinb1b
Name: serine (or cysteine) peptidase inhibitor, clade B, member 1b
Synonyms: ovalbumin, 6330533H24Rik, EIB
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 282663
HGNC: HGNC:3311
Homologene: 138408
Cldn10
Name: claudin 10
Synonyms: 6720456I16Rik, Cldn10a, D14Ertd728e, Cldn10b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 58187
HGNC: HGNC:2033
Homologene: 5076
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Fam20b
Name: FAM20B, glycosaminoglycan xylosylkinase
Synonyms: C530043G21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215015
Homologene: 8909
Parp9
Name: poly (ADP-ribose) polymerase family, member 9
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 80285
Homologene: 12720
Atf6b
Name: activating transcription factor 6 beta
Synonyms: Crebl1, Creb-rp, ATF6beta
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12915
HGNC: HGNC:2349
Homologene: 31238
Cdhr18
Name: cadherin related family member 18
Synonyms: LOC238939, Gm281
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 238939
Homologene: 141164
Cfhr4
Name: complement factor H-related 4
Synonyms: Gm4788
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214403
HGNC: HGNC:4883
Rxfp2
Name: relaxin/insulin-like family peptide receptor 2
Synonyms: LGR8, Great, Gpr106
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140498
Homologene: 15402
Cd226
Name: CD226 antigen
Synonyms: DNAM-1, TLiSA1, DNAM1, Pta1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225825
Homologene: 4787
Clcnkb
Name: chloride channel, voltage-sensitive Kb
Synonyms: Clck2, ClC-K2, Clcnk1l, Clcnk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56365
Homologene: 107317
Usp43
Name: ubiquitin specific peptidase 43
Synonyms: C630032K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216835
Homologene: 129879
Sgsm2
Name: small G protein signaling modulator 2
Synonyms: Rutbc1, D630003G22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 97761
Homologene: 14780
Micu2
Name: mitochondrial calcium uptake 2
Synonyms: 1110008L20Rik, 4833427E09Rik, Efha1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68514
VEGA: 14
Homologene: 12516
Krt77
Name: keratin 77
Synonyms: 4732484G22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 406220
Homologene: 45490
Begain
Name: brain-enriched guanylate kinase-associated
Synonyms: LOC380785
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380785
Homologene: 10829
Flt4
Name: FMS-like tyrosine kinase 4
Synonyms: Flt-4, VEGFR3, VEGFR-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14257
HGNC: HGNC:3767
Homologene: 7321
Or5p50
Name: olfactory receptor family 5 subfamily P member 50
Synonyms: Olfr469, GA_x6K02T2PBJ9-10152980-10152036, MOR204-21
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258418
Homologene: 44979
Ky
Name: kyphoscoliosis peptidase
Synonyms: D9Mgc44e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16716
Homologene: 11506
Mks1
Name: MKS transition zone complex subunit 1
Synonyms: Meckel syndrome, type 1, B8d3, avc6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380718
HGNC: HGNC:7121
Homologene: 9833
Tmem151a
Name: transmembrane protein 151A
Synonyms: LOC381199, Gm30627, Tmem151
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381199
Homologene: 17721
Or4c103
Name: olfactory receptor family 4 subfamily C member 103
Synonyms: Olfr1195, MOR230-4, MOR230-12_p, GA_x6K02T2Q125-50163514-50162588
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258748
Homologene: 103782
Gtpbp6
Name: GTP binding protein 6 (putative)
Synonyms: Pgbpll, pgpl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 107999
Homologene: 8157
Ggcx
Name: gamma-glutamyl carboxylase
Synonyms: vitamin K-dependent carboxylase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56316
HGNC: HGNC:4247
Homologene: 639
Tmem132a
Name: transmembrane protein 132A
Synonyms: Hspa5bp1, 6720481D13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 98170
Homologene: 75076
Fmo3
Name: flavin containing monooxygenase 3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14262
HGNC: HGNC:3771
Homologene: 128199
Tspan32
Name: tetraspanin 32
Synonyms: Tspan32, Art-1, D7Wsu37e, Phemx, Tssc6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27027
Homologene: 10650
Arhgap27
Name: Rho GTPase activating protein 27
Synonyms: Sh3d20, 5730442P18Rik, 2310069I04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544817
Homologene: 45715
Galnt17
Name: polypeptide N-acetylgalactosaminyltransferase 17
Synonyms: Galnt19, Wbscr17, E330012B09Rik, Gcap8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212996
Homologene: 49707
Cpa5
Name: carboxypeptidase A5
Synonyms: 4930430M09Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74649
Homologene: 62246
Rbms3
Name: RNA binding motif, single stranded interacting protein
Synonyms: 8430436O14Rik, 6720477E09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 207181
Homologene: 49388
Cnn1
Name: calponin 1
Synonyms: CnnI, CN, calponin h1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12797
VEGA: 9
HGNC: HGNC:2155
Homologene: 995
Cd200r4
Name: CD200 receptor 4
Synonyms: F630107N04Rik, MCD200RLa
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239849
Homologene: 45557
Wnt2
Name: wingless-type MMTV integration site family, member 2
Synonyms: Wnt-2, m-irp, 2610510E18Rik, Irp, Wnt2a, Int1l1, Mirp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22413
Homologene: 20719
Cstdc5
Name: cystatin domain containing 5
Synonyms: BC100530
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 100034684
HGNC: HGNC:2481
Homologene: 104045
Or6b3
Name: olfactory receptor family 6 subfamily B member 3
Synonyms: MOR103-2, GA_x6K02T2R7CC-81245243-81246181, Olfr1414
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 259041
Homologene: 88368
Or6d12
Name: olfactory receptor family 6 subfamily D member 12
Synonyms: Olfr212, 4931403F16Rik, MOR119-4, GA_x54KRFPKN04-58149882-58150865
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258019
Homologene: 74186
Sars2
Name: seryl-aminoacyl-tRNA synthetase 2
Synonyms: D7Ertd353e, 2410015F05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71984
Homologene: 6073
Rab11b
Name: RAB11B, member RAS oncogene family
Synonyms: A730055L17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19326
HGNC: HGNC:9761
Homologene: 68691
Otub2
Name: OTU domain, ubiquitin aldehyde binding 2
Synonyms: 2010015L18Rik, 4930586I02Rik, OTU2, OTB2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68149
Homologene: 57056
Nps
Name: neuropeptide S
Synonyms: ENSMUSG00000073804
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043254
Homologene: 106066
Ugt2a2
Name: UDP glucuronosyltransferase 2 family, polypeptide A2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 552899
Homologene: 115736
Msantd5f3
Name: Myb/SANT DNA binding domain containing 5 family member 3
Synonyms: Gm11238
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100502896
Homologene: 128423
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 43,816,958 bp
  • T to A, chromosome 1 at 91,091,616 bp
  • A to T, chromosome 1 at 92,511,851 bp
  • A to T, chromosome 1 at 139,753,050 bp
  • G to A, chromosome 1 at 150,102,761 bp
  • C to A, chromosome 1 at 156,702,398 bp
  • T to A, chromosome 1 at 162,954,288 bp
  • A to G, chromosome 1 at 175,789,933 bp
  • T to C, chromosome 2 at 52,196,356 bp
  • T to C, chromosome 2 at 88,683,423 bp
  • T to C, chromosome 2 at 91,767,758 bp
  • C to T, chromosome 3 at 49,755,474 bp
  • A to G, chromosome 3 at 88,965,952 bp
  • A to T, chromosome 3 at 148,858,949 bp
  • A to G, chromosome 4 at 45,914,588 bp
  • A to G, chromosome 4 at 73,654,920 bp
  • A to G, chromosome 4 at 132,113,801 bp
  • A to G, chromosome 4 at 138,293,766 bp
  • A to T, chromosome 4 at 141,408,635 bp
  • T to A, chromosome 5 at 26,261,118 bp
  • T to A, chromosome 5 at 74,588,075 bp
  • T to C, chromosome 5 at 87,460,609 bp
  • A to T, chromosome 5 at 104,310,431 bp
  • A to G, chromosome 5 at 110,104,612 bp
  • C to T, chromosome 5 at 115,670,281 bp
  • C to A, chromosome 5 at 131,306,752 bp
  • A to T, chromosome 5 at 144,842,707 bp
  • A to T, chromosome 5 at 150,059,899 bp
  • C to A, chromosome 5 at 150,059,903 bp
  • G to T, chromosome 6 at 18,028,047 bp
  • C to A, chromosome 6 at 30,630,830 bp
  • T to C, chromosome 6 at 72,428,004 bp
  • A to T, chromosome 6 at 90,598,275 bp
  • A to G, chromosome 6 at 116,515,975 bp
  • A to T, chromosome 6 at 119,943,878 bp
  • A to G, chromosome 7 at 5,454,726 bp
  • A to T, chromosome 7 at 7,181,563 bp
  • G to T, chromosome 7 at 28,744,308 bp
  • A to T, chromosome 7 at 30,533,009 bp
  • A to T, chromosome 7 at 35,202,626 bp
  • G to T, chromosome 7 at 56,182,640 bp
  • G to T, chromosome 7 at 66,025,408 bp
  • T to A, chromosome 7 at 97,535,226 bp
  • C to A, chromosome 7 at 99,269,050 bp
  • A to T, chromosome 7 at 102,195,041 bp
  • T to C, chromosome 7 at 107,822,575 bp
  • A to T, chromosome 7 at 120,394,364 bp
  • A to G, chromosome 7 at 123,306,438 bp
  • T to C, chromosome 7 at 131,277,623 bp
  • T to A, chromosome 7 at 135,268,781 bp
  • AGGCGCAGAAACCCTGGC to AGGC, chromosome 7 at 141,634,450 bp
  • G to T, chromosome 7 at 143,005,126 bp
  • C to T, chromosome 8 at 70,340,045 bp
  • T to A, chromosome 8 at 95,077,921 bp
  • T to A, chromosome 9 at 22,105,782 bp
  • C to A, chromosome 9 at 64,020,406 bp
  • T to G, chromosome 9 at 102,542,292 bp
  • C to T, chromosome 9 at 116,586,017 bp
  • T to C, chromosome 9 at 119,613,550 bp
  • C to T, chromosome 9 at 123,822,426 bp
  • T to C, chromosome 10 at 78,210,428 bp
  • A to T, chromosome 10 at 82,289,327 bp
  • T to C, chromosome 11 at 3,712,134 bp
  • C to T, chromosome 11 at 36,049,129 bp
  • A to G, chromosome 11 at 49,634,298 bp
  • A to T, chromosome 11 at 61,834,831 bp
  • C to T, chromosome 11 at 67,883,284 bp
  • T to A, chromosome 11 at 74,854,493 bp
  • T to A, chromosome 11 at 87,856,602 bp
  • A to G, chromosome 11 at 98,224,625 bp
  • A to C, chromosome 11 at 103,344,541 bp
  • G to A, chromosome 11 at 115,251,050 bp
  • T to G, chromosome 12 at 8,005,087 bp
  • C to A, chromosome 12 at 103,392,904 bp
  • T to C, chromosome 12 at 109,038,868 bp
  • A to G, chromosome 13 at 33,087,423 bp
  • A to T, chromosome 13 at 55,246,470 bp
  • C to G, chromosome 13 at 59,788,550 bp
  • C to T, chromosome 13 at 81,479,658 bp
  • T to C, chromosome 14 at 13,866,032 bp
  • G to A, chromosome 14 at 26,778,912 bp
  • T to G, chromosome 14 at 54,884,601 bp
  • G to T, chromosome 14 at 57,954,149 bp
  • T to C, chromosome 14 at 118,861,843 bp
  • A to G, chromosome 15 at 10,493,257 bp
  • T to C, chromosome 15 at 76,249,087 bp
  • T to C, chromosome 15 at 77,783,472 bp
  • A to G, chromosome 15 at 84,933,658 bp
  • G to A, chromosome 15 at 101,869,371 bp
  • A to T, chromosome 16 at 35,956,990 bp
  • T to C, chromosome 16 at 36,367,447 bp
  • A to G, chromosome 16 at 36,875,301 bp
  • G to T, chromosome 16 at 44,833,166 bp
  • TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,295 bp
  • G to A, chromosome 17 at 33,749,867 bp
  • T to C, chromosome 17 at 34,653,729 bp
  • G to A, chromosome 17 at 34,850,936 bp
  • C to T, chromosome 17 at 65,985,165 bp
  • A to G, chromosome 17 at 66,130,771 bp
  • G to A, chromosome 18 at 89,247,198 bp
  • A to G, chromosome 19 at 5,082,773 bp
  • T to A, chromosome 19 at 10,866,931 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7205 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045283-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.