Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7217Btlr/Mmmh
Stock Number:
045289-MU
Citation ID:
RRID:MMRRC_045289-MU
Other Names:
R7217 (G1)
Major Collection:

Strain Information

Aven
Name: apoptosis, caspase activation inhibitor
Synonyms: 1700013A01Rik, mAven-S, mAven-L, 1700056A21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74268
Homologene: 10683
Grin3a
Name: glutamate receptor ionotropic, NMDA3A
Synonyms: NMDAR-L, NR3A, A830097C19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242443
Homologene: 128613
Kif20a
Name: kinesin family member 20A
Synonyms: Rabkinesin-6, Rab6kifl
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19348
VEGA: 18
HGNC: HGNC:9787
Homologene: 38093
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: med, seal, motor end-plate disease, nmf2, ataxia 3, mnd2, mnd-2, C630029C19Rik, nmf58, NaCh6, Nav1.6, nmf335, NMF335, nur14
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20273
Homologene: 7927
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Rbm25
Name: RNA binding motif protein 25
Synonyms: 2610015J01Rik, A130095G20Rik, 2600011C06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67039
Kif13b
Name: kinesin family member 13B
Synonyms: GAKIN, N-3 kinesin, C130021D12Rik, 5330429L19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16554
VEGA: 14
Homologene: 9073
Kat7
Name: K(lysine) acetyltransferase 7
Synonyms: Hbo1, Hboa, Myst2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217127
Homologene: 5134
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Mlh3
Name: mutL homolog 3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217716
VEGA: 12
HGNC: HGNC:7128
Homologene: 91153
Rims2
Name: regulating synaptic membrane exocytosis 2
Synonyms: RIM2, 2810036I15Rik, Syt3-rs
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 116838
VEGA: 15
Homologene: 81639
Ccdc138
Name: coiled-coil domain containing 138
Synonyms: 6230424H07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76138
VEGA: 10
Homologene: 44912
Grm7
Name: glutamate receptor, metabotropic 7
Synonyms: mGluR7, Gpr1g, E130018M02Rik, 6330570A01Rik, mGlu7a receptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108073
HGNC: HGNC:4599
Homologene: 20233
Gpr68
Name: G protein-coupled receptor 68
Synonyms: OGR1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238377
HGNC: HGNC:4519
Homologene: 2603
Car14
Name: carbonic anhydrase 14
Synonyms: CA XIV
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23831
HGNC: HGNC:1372
Homologene: 69105
Fcrl5
Name: Fc receptor-like 5
Synonyms: BXMAS1-like protein 2, Fcrh3, mBXMH2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329693
Homologene: 137404
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Brd9
Name: bromodomain containing 9
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105246
VEGA: 13
Homologene: 82462
Trnp1
Name: TMF1-regulated nuclear protein 1
Synonyms: 2300002D11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69539
Homologene: 19492
Foxp2
Name: forkhead box P2
Synonyms: 2810043D05Rik, D0Kist7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 114142
Homologene: 134404
Mep1b
Name: meprin 1 beta
Synonyms: meprin beta, Mep-1b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17288
VEGA: 18
HGNC: HGNC:7020
Homologene: 48382
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Epha3
Name: Eph receptor A3
Synonyms: Tyro4, Mek4, Hek4, Hek, Cek4, End3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13837
VEGA: 16
HGNC: HGNC:3387
Homologene: 21083
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Slc35b2
Name: solute carrier family 35, member B2
Synonyms: 1110003M08Rik, PAPST1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73836
VEGA: 17
Homologene: 24504
Eno1b
Name: enolase 1B, retrotransposed
Synonyms: Gm5506
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 433182
VEGA: 18
HGNC: HGNC:3350
Homologene: 134343
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329015
Homologene: 86985
Abcg3
Name: ATP binding cassette subfamily G member 3
Synonyms: Mxr2, Abcp2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27405
HGNC: HGNC:74
Homologene: 86845
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76645
Homologene: 124481
A430033K04Rik
Name: RIKEN cDNA A430033K04 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243308
Homologene: 65621
Gcnt4
Name: glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)
Synonyms: LOC238786, LOC218476, C2GNT3, Gm73
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218476
VEGA: 13
Homologene: 41144
Ttll13
Name: tubulin tyrosine ligase-like family, member 13
Synonyms: 1700111A04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269954
Homologene: 136186
Prpf18
Name: pre-mRNA processing factor 18
Synonyms: 2810441A10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67229
Homologene: 2726
Prl8a2
Name: prolactin family 8, subfamily a, member 2
Synonyms: D/tPRP, DPRP, mdPRP, Dtprp
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13529
Homologene: 49230
Hoxb4
Name: homeobox B4
Synonyms: Hox-2.6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15412
HGNC: HGNC:5115
Homologene: 32095
Gm11127
Name: predicted gene 11127
Synonyms: Gm11127
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100529082
Homologene: 133121
Zfp131
Name: zinc finger protein 131
Synonyms: Znf131, 2610109I01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72465
VEGA: 13
Homologene: 12464
Pxmp2
Name: peroxisomal membrane protein 2
Synonyms: PMP22, 22kDa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19301
HGNC: HGNC:9716
Homologene: 32062
Asnsd1
Name: asparagine synthetase domain containing 1
Synonyms: 2210409M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70396
Homologene: 6564
Zfp729b
Name: zinc finger protein 729b
Synonyms: AA987161
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100416706
Homologene: 133713
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,348,193 bp
  • A to G, chromosome 2 at 4,645,624 bp
  • A to T, chromosome 2 at 82,989,068 bp
  • T to A, chromosome 2 at 112,630,846 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • C to T, chromosome 3 at 87,443,774 bp
  • A to G, chromosome 3 at 95,899,317 bp
  • A to T, chromosome 4 at 49,770,741 bp
  • T to C, chromosome 4 at 133,498,105 bp
  • A to T, chromosome 5 at 101,901,919 bp
  • A to G, chromosome 5 at 104,939,228 bp
  • A to G, chromosome 5 at 110,285,905 bp
  • C to A, chromosome 5 at 138,646,926 bp
  • A to T, chromosome 6 at 15,416,024 bp
  • A to G, chromosome 6 at 111,358,824 bp
  • A to C, chromosome 7 at 80,254,163 bp
  • CGGC to CGGCGGCGGGGGC, chromosome 7 at 97,579,932 bp
  • T to C, chromosome 7 at 135,704,182 bp
  • A to G, chromosome 8 at 116,995,797 bp
  • A to T, chromosome 9 at 18,644,076 bp
  • T to G, chromosome 10 at 58,452,017 bp
  • T to C, chromosome 10 at 58,509,600 bp
  • A to G, chromosome 11 at 95,291,564 bp
  • A to G, chromosome 11 at 96,319,080 bp
  • G to A, chromosome 12 at 83,664,217 bp
  • A to G, chromosome 12 at 85,266,707 bp
  • A to G, chromosome 12 at 100,878,799 bp
  • A to G, chromosome 13 at 27,351,015 bp
  • A to G, chromosome 13 at 67,595,248 bp
  • T to C, chromosome 13 at 73,938,944 bp
  • A to G, chromosome 13 at 93,090,430 bp
  • T to C, chromosome 13 at 96,946,310 bp
  • A to G, chromosome 13 at 119,775,841 bp
  • T to C, chromosome 14 at 64,773,068 bp
  • C to A, chromosome 15 at 39,476,489 bp
  • A to T, chromosome 15 at 100,970,227 bp
  • T to C, chromosome 16 at 63,552,494 bp
  • A to C, chromosome 17 at 36,056,343 bp
  • A to G, chromosome 17 at 45,565,029 bp
  • A to T, chromosome 17 at 67,764,673 bp
  • T to A, chromosome 18 at 21,093,543 bp
  • T to A, chromosome 18 at 34,629,560 bp
  • C to A, chromosome 18 at 48,047,679 bp
  • G to T, chromosome 19 at 6,253,441 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7217 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045289-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text