Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7235Btlr/Mmmh
Stock Number:
045305-MU
Citation ID:
RRID:MMRRC_045305-MU
Other Names:
R7235 (G1)
Major Collection:

Strain Information

Kcnj10
Name: potassium inwardly-rectifying channel, subfamily J, member 10
Synonyms: Kir1.2, BIRK-1, BIR10, Kir4.1, Kir4.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16513
HGNC: HGNC:6256
Homologene: 1689
Evl
Name: Ena-vasodilator stimulated phosphoprotein
Synonyms: b2b2600Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14026
VEGA: 12
Homologene: 56752
Pias3
Name: protein inhibitor of activated STAT 3
Synonyms: Pias3L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229615
Homologene: 4447
Bri3bp
Name: Bri3 binding protein
Synonyms: 2410150I18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76809
Homologene: 50955
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Rabep1
Name: rabaptin, RAB GTPase binding effector protein 1
Synonyms: RAB5 effector protein, neurocrescin, rabaptin-5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54189
Homologene: 3451
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 43,764,927 bp
  • A to C, chromosome 1 at 44,178,203 bp
  • A to G, chromosome 1 at 66,414,648 bp
  • T to C, chromosome 1 at 67,038,535 bp
  • T to C, chromosome 1 at 172,369,426 bp
  • T to C, chromosome 2 at 37,801,061 bp
  • T to G, chromosome 2 at 85,500,219 bp
  • T to C, chromosome 2 at 120,433,717 bp
  • T to A, chromosome 3 at 96,704,363 bp
  • C to T, chromosome 3 at 102,949,042 bp
  • G to T, chromosome 4 at 73,917,571 bp
  • A to T, chromosome 4 at 94,923,699 bp
  • T to C, chromosome 4 at 114,908,271 bp
  • A to G, chromosome 4 at 124,751,392 bp
  • A to G, chromosome 4 at 129,083,778 bp
  • A to T, chromosome 4 at 134,212,581 bp
  • A to G, chromosome 4 at 136,693,828 bp
  • C to G, chromosome 5 at 93,273,343 bp
  • T to C, chromosome 5 at 113,753,642 bp
  • T to A, chromosome 5 at 113,776,882 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • A to G, chromosome 5 at 125,441,684 bp
  • A to G, chromosome 6 at 3,588,078 bp
  • T to G, chromosome 6 at 87,753,798 bp
  • A to G, chromosome 6 at 89,340,591 bp
  • T to C, chromosome 7 at 43,773,299 bp
  • T to A, chromosome 7 at 44,541,820 bp
  • C to T, chromosome 7 at 45,280,758 bp
  • T to C, chromosome 7 at 65,318,573 bp
  • T to C, chromosome 7 at 102,125,284 bp
  • C to T, chromosome 7 at 104,892,719 bp
  • T to C, chromosome 7 at 108,938,088 bp
  • T to C, chromosome 7 at 120,032,670 bp
  • A to G, chromosome 8 at 22,914,269 bp
  • T to C, chromosome 8 at 80,690,725 bp
  • T to C, chromosome 8 at 106,015,955 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to G, chromosome 9 at 21,587,405 bp
  • C to T, chromosome 9 at 55,544,171 bp
  • T to C, chromosome 9 at 97,369,708 bp
  • C to T, chromosome 9 at 108,494,924 bp
  • T to A, chromosome 9 at 108,510,132 bp
  • T to C, chromosome 9 at 114,715,163 bp
  • A to G, chromosome 10 at 111,269,427 bp
  • T to A, chromosome 11 at 30,950,751 bp
  • A to G, chromosome 11 at 51,276,185 bp
  • A to C, chromosome 11 at 59,080,840 bp
  • A to G, chromosome 11 at 70,940,464 bp
  • C to T, chromosome 11 at 86,138,875 bp
  • A to G, chromosome 12 at 28,470,719 bp
  • G to A, chromosome 12 at 108,648,460 bp
  • G to A, chromosome 13 at 55,663,240 bp
  • A to T, chromosome 13 at 62,518,150 bp
  • G to A, chromosome 14 at 66,157,087 bp
  • A to G, chromosome 16 at 9,579,265 bp
  • G to A, chromosome 16 at 15,714,263 bp
  • T to A, chromosome 16 at 16,304,692 bp
  • T to A, chromosome 16 at 34,175,761 bp
  • T to A, chromosome 16 at 49,001,059 bp
  • A to T, chromosome 17 at 25,020,645 bp
  • T to C, chromosome 18 at 20,399,423 bp
  • G to A, chromosome 18 at 69,657,795 bp
  • T to A, chromosome 19 at 9,012,488 bp
  • A to G, chromosome 19 at 58,775,227 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7235 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045305-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.