Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7235Btlr/Mmmh
Stock Number:
045305-MU
Citation ID:
RRID:MMRRC_045305-MU
Other Names:
R7235 (G1)
Major Collection:

Strain Information

Kcnj10
Name: potassium inwardly-rectifying channel, subfamily J, member 10
Synonyms: Kir1.2, BIRK-1, BIR10, Kir4.1, Kir4.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16513
HGNC: HGNC:6256
Homologene: 1689
Evl
Name: Ena-vasodilator stimulated phosphoprotein
Synonyms: b2b2600Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14026
VEGA: 12
Homologene: 56752
Pias3
Name: protein inhibitor of activated STAT 3
Synonyms: Pias3L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229615
Homologene: 4447
Bri3bp
Name: Bri3 binding protein
Synonyms: 2410150I18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76809
Homologene: 50955
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Rabep1
Name: rabaptin, RAB GTPase binding effector protein 1
Synonyms: RAB5 effector protein, neurocrescin, rabaptin-5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54189
Homologene: 3451
Plxna1
Name: plexin A1
Synonyms: NOV, Plxn1, 2600013D04Rik, PlexA1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18844
HGNC: HGNC:9099
Homologene: 56426
Osbpl8
Name: oxysterol binding protein-like 8
Synonyms: ORP-8, D330025H14Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237542
VEGA: 10
Homologene: 68813
Usp19
Name: ubiquitin specific peptidase 19
Synonyms: 8430421I07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71472
Homologene: 41730
Sart3
Name: squamous cell carcinoma antigen recognized by T cells 3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53890
Homologene: 40977
Ddx46
Name: DEAD box helicase 46
Synonyms: 2200005K02Rik, 8430438J23Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212880
VEGA: 13
Homologene: 5430
Pold1
Name: polymerase (DNA directed), delta 1, catalytic subunit
Synonyms: 125kDa
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18971
HGNC: HGNC:9175
Homologene: 2014
Cip2a
Name: cell proliferation regulating inhibitor of protein phosphatase 2A
Synonyms: Cip2a, C330027C09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224171
Homologene: 10842
Tcf4
Name: transcription factor 4
Synonyms: SEF-2, ITF-2, MITF-2B, MITF-2A, ME2, E2.2, TFE, E2-2, SEF2-1, ASP-I2, ITF-2b, 5730422P05Rik, bHLHb19
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21413
Homologene: 2407
Vps50
Name: VPS50 EARP/GARPII complex subunit
Synonyms: 8430415E05Rik, 1700034M03Rik, Ccdc132
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73288
Homologene: 11498
Tjp1
Name: tight junction protein 1
Synonyms: ZO-1, ZO1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21872
Homologene: 2445
Yars2
Name: tyrosyl-tRNA synthetase 2 (mitochondrial)
Synonyms: 2210023C10Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70120
Homologene: 7097
Isl2
Name: insulin related protein 2 (islet 2)
Synonyms: islet 2, islet-2, 3110001N10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104360
Homologene: 10730
Klk12
Name: kallikrein related-peptidase 12
Synonyms: KLK-L5, 2310008B01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69511
HGNC: HGNC:6360
Homologene: 44690
Map2
Name: microtubule-associated protein 2
Synonyms: MAP-2, G1-397-34, Mtap2, repro4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17756
HGNC: HGNC:6839
Homologene: 1779
Inpp5b
Name: inositol polyphosphate-5-phosphatase B
Synonyms: 75kDa
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16330
HGNC: HGNC:6077
Homologene: 69021
Carm1
Name: coactivator-associated arginine methyltransferase 1
Synonyms: Prmt4, m9Bei
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 59035
Homologene: 10990
Dync1li1
Name: dynein cytoplasmic 1 light intermediate chain 1
Synonyms: LIC-1, 1110053F02Rik, Dnclic1, Dlic1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235661
VEGA: 9
Homologene: 9403
Kat6a
Name: K(lysine) acetyltransferase 6A
Synonyms: MOZ, Zfp220, 9930021N24Rik, Myst3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244349
Homologene: 4924
Dennd1a
Name: DENN domain containing 1A
Synonyms: 6030446I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227801
Homologene: 17141
Brip1
Name: BRCA1 interacting protein C-terminal helicase 1
Synonyms: 8030460J03Rik, BACH1, 3110009N10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237911
Homologene: 32766
Kalrn
Name: kalirin, RhoGEF kinase
Synonyms: LOC224126, Hapip, 2210407G14Rik, E530005C20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 545156
HGNC: HGNC:4814
Homologene: 57160
Uxs1
Name: UDP-glucuronate decarboxylase 1
Synonyms: 1600025I13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67883
Homologene: 41609
Ercc5
Name: excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms: Xpg
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22592
HGNC: HGNC:3437
Homologene: 133551
Ephb2
Name: Eph receptor B2
Synonyms: eteck, Erk, Tyro5, Prkm5, Nuk, Drt, Hek5, Sek3, Qek5, Cek5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13844
HGNC: HGNC:3393
Homologene: 37925
Eif3f
Name: eukaryotic translation initiation factor 3, subunit F
Synonyms: 0610037M02Rik, Eif3s5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66085
HGNC: HGNC:3275
Homologene: 2783
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Nr1h5
Name: nuclear receptor subfamily 1, group H, member 5
Synonyms: FXRB
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381463
Homologene: 131277
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Grin2a
Name: glutamate receptor, ionotropic, NMDA2A (epsilon 1)
Synonyms: NR2A, NMDAR2A, GluRepsilon1, GluN2A
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14811
HGNC: HGNC:4585
Homologene: 645
Dsg1b
Name: desmoglein 1 beta
Synonyms: Dsg5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225256
HGNC: HGNC:3048
Homologene: 1463
Fads2b
Name: fatty acid desaturase 2B
Synonyms: 4833423E24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228151
Homologene: 105643
Eqtn
Name: equatorin, sperm acrosome associated
Synonyms: 1700028B15Rik, Afaf, equatorin, 4930579C15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67753
HGNC: HGNC:1359
Homologene: 75250
Frem3
Name: Fras1 related extracellular matrix protein 3
Synonyms: LOC333315
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 333315
Homologene: 35388
Ift140
Name: intraflagellar transport 140
Synonyms: Wdtc2, Tce5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106633
Homologene: 40979
Trim42
Name: tripartite motif-containing 42
Synonyms: 4930486B16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78911
Homologene: 12712
Pnliprp2
Name: pancreatic lipase-related protein 2
Synonyms: PLRP2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18947
VEGA: 19
HGNC: HGNC:9157
Homologene: 3936
Efcc1
Name: EF hand and coiled-coil domain containing 1
Synonyms: AB041550, Ccdc48
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58229
Homologene: 130011
Slc6a21
Name: solute carrier family 6 member 21
Synonyms: 1700039E15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76713
Homologene: 66347
Ptk2b
Name: PTK2 protein tyrosine kinase 2 beta
Synonyms: CAKbeta, Raftk, calcium-dependent tyrosine kinase, related adhesion focal tyrosine kinase, cellular adhesion kinase beta, proline-rich tyrosine kinase 2, PYK2, E430023O05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19229
HGNC: HGNC:9612
Homologene: 23001
Or52n2
Name: olfactory receptor family 52 subfamily N member 2
Synonyms: GA_x6K02T2PBJ9-7522449-7521493, MOR34-1, Olfr666
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259100
Homologene: 64956
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Dus2
Name: dihydrouridine synthase 2
Synonyms: 2310016K04Rik, Dus2l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66369
Homologene: 6838
Ganc
Name: glucosidase, alpha; neutral C
Synonyms: 5830445O15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76051
HGNC: HGNC:4139
Homologene: 25627
Lancl1
Name: LanC (bacterial lantibiotic synthetase component C)-like 1
Synonyms: p40, LanC-like protein 1, Gpr69a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14768
HGNC: HGNC:6508
Homologene: 4417
Qars1
Name: glutaminyl-tRNA synthetase 1
Synonyms: 1110018N24Rik, 1200016L19Rik, Qars
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 97541
HGNC: HGNC:9751
Homologene: 133975
Rnf19b
Name: ring finger protein 19B
Synonyms: 4930534K13Rik, 4930555L03Rik, Ibrdc3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75234
Homologene: 34999
Erlec1
Name: endoplasmic reticulum lectin 1
Synonyms: 4933407N01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66753
Homologene: 9247
Catsper4
Name: cation channel, sperm associated 4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329954
Homologene: 18638
Foxd2
Name: forkhead box D2
Synonyms: Mf2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17301
HGNC: HGNC:3803
Homologene: 3292
Dcdc2c
Name: doublecortin domain containing 2C
Synonyms: 1110015M06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68511
Homologene: 131934
Msantd5f9
Name: Myb/SANT DNA binding domain containing 5 family member 9
Synonyms: Gm11756
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 623281
Iscu
Name: iron-sulfur cluster assembly enzyme
Synonyms: 2310020H20Rik, Nifun
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66383
Homologene: 6991
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 43,764,927 bp
  • A to C, chromosome 1 at 44,178,203 bp
  • A to G, chromosome 1 at 66,414,648 bp
  • T to C, chromosome 1 at 67,038,535 bp
  • T to C, chromosome 1 at 172,369,426 bp
  • T to C, chromosome 2 at 37,801,061 bp
  • T to G, chromosome 2 at 85,500,219 bp
  • T to C, chromosome 2 at 120,433,717 bp
  • T to A, chromosome 3 at 96,704,363 bp
  • C to T, chromosome 3 at 102,949,042 bp
  • G to T, chromosome 4 at 73,917,571 bp
  • A to T, chromosome 4 at 94,923,699 bp
  • T to C, chromosome 4 at 114,908,271 bp
  • A to G, chromosome 4 at 124,751,392 bp
  • A to G, chromosome 4 at 129,083,778 bp
  • A to T, chromosome 4 at 134,212,581 bp
  • A to G, chromosome 4 at 136,693,828 bp
  • C to G, chromosome 5 at 93,273,343 bp
  • T to C, chromosome 5 at 113,753,642 bp
  • T to A, chromosome 5 at 113,776,882 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • A to G, chromosome 5 at 125,441,684 bp
  • A to G, chromosome 6 at 3,588,078 bp
  • T to G, chromosome 6 at 87,753,798 bp
  • A to G, chromosome 6 at 89,340,591 bp
  • T to C, chromosome 7 at 43,773,299 bp
  • T to A, chromosome 7 at 44,541,820 bp
  • C to T, chromosome 7 at 45,280,758 bp
  • T to C, chromosome 7 at 65,318,573 bp
  • T to C, chromosome 7 at 102,125,284 bp
  • C to T, chromosome 7 at 104,892,719 bp
  • T to C, chromosome 7 at 108,938,088 bp
  • T to C, chromosome 7 at 120,032,670 bp
  • A to G, chromosome 8 at 22,914,269 bp
  • T to C, chromosome 8 at 80,690,725 bp
  • T to C, chromosome 8 at 106,015,955 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to G, chromosome 9 at 21,587,405 bp
  • C to T, chromosome 9 at 55,544,171 bp
  • T to C, chromosome 9 at 97,369,708 bp
  • C to T, chromosome 9 at 108,494,924 bp
  • T to A, chromosome 9 at 108,510,132 bp
  • T to C, chromosome 9 at 114,715,163 bp
  • A to G, chromosome 10 at 111,269,427 bp
  • T to A, chromosome 11 at 30,950,751 bp
  • A to G, chromosome 11 at 51,276,185 bp
  • A to C, chromosome 11 at 59,080,840 bp
  • A to G, chromosome 11 at 70,940,464 bp
  • C to T, chromosome 11 at 86,138,875 bp
  • A to G, chromosome 12 at 28,470,719 bp
  • G to A, chromosome 12 at 108,648,460 bp
  • G to A, chromosome 13 at 55,663,240 bp
  • A to T, chromosome 13 at 62,518,150 bp
  • G to A, chromosome 14 at 66,157,087 bp
  • A to G, chromosome 16 at 9,579,265 bp
  • G to A, chromosome 16 at 15,714,263 bp
  • T to A, chromosome 16 at 16,304,692 bp
  • T to A, chromosome 16 at 34,175,761 bp
  • T to A, chromosome 16 at 49,001,059 bp
  • A to T, chromosome 17 at 25,020,645 bp
  • T to C, chromosome 18 at 20,399,423 bp
  • G to A, chromosome 18 at 69,657,795 bp
  • T to A, chromosome 19 at 9,012,488 bp
  • A to G, chromosome 19 at 58,775,227 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7235 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045305-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.