Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7243Btlr/Mmmh
Stock Number:
045307-MU
Citation ID:
RRID:MMRRC_045307-MU
Other Names:
R7243 (G1)
Major Collection:

Strain Information

Lrig2
Name: leucine-rich repeats and immunoglobulin-like domains 2
Synonyms: 4632419I10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269473
Homologene: 8882
Dspp
Name: dentin sialophosphoprotein
Synonyms: Dmp3, Dpp, Dsp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666279
HGNC: HGNC:3054
Odc1
Name: ornithine decarboxylase, structural 1
Synonyms: ODC
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18263
VEGA: 12
HGNC: HGNC:8109
Homologene: 1906
Etv1
Name: ets variant 1
Synonyms: ER81, Etsrp81
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14009
HGNC: HGNC:3490
Homologene: 3636
Pcf11
Name: PCF11 cleavage and polyadenylation factor subunit
Synonyms: 5730417B17Rik, 2500001H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74737
Homologene: 32282
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Kdm1a
Name: lysine (K)-specific demethylase 1A
Synonyms: 1810043O07Rik, LSD1, Aof2, Kdm1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 99982
Homologene: 32240
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 45,376,160 bp
  • A to G, chromosome 1 at 46,083,754 bp
  • G to T, chromosome 1 at 58,138,307 bp
  • A to T, chromosome 1 at 58,591,123 bp
  • C to T, chromosome 1 at 160,107,117 bp
  • A to T, chromosome 2 at 3,118,616 bp
  • T to A, chromosome 2 at 11,751,525 bp
  • A to G, chromosome 2 at 21,212,847 bp
  • A to G, chromosome 2 at 62,303,862 bp
  • A to G, chromosome 2 at 66,540,530 bp
  • T to C, chromosome 2 at 90,446,421 bp
  • T to C, chromosome 2 at 151,594,253 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • A to T, chromosome 3 at 53,002,315 bp
  • G to T, chromosome 3 at 58,416,463 bp
  • T to A, chromosome 3 at 86,751,516 bp
  • A to G, chromosome 3 at 87,442,245 bp
  • A to T, chromosome 3 at 104,497,567 bp
  • G to T, chromosome 3 at 119,753,112 bp
  • A to T, chromosome 3 at 159,909,765 bp
  • T to C, chromosome 4 at 11,980,113 bp
  • T to C, chromosome 4 at 70,435,471 bp
  • A to G, chromosome 4 at 136,551,954 bp
  • T to C, chromosome 5 at 34,198,875 bp
  • C to A, chromosome 5 at 86,530,116 bp
  • T to A, chromosome 5 at 88,743,445 bp
  • TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG to TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG, chromosome 5 at 104,178,361 bp
  • A to G, chromosome 5 at 145,858,803 bp
  • T to A, chromosome 6 at 115,972,507 bp
  • C to T, chromosome 6 at 118,637,729 bp
  • C to A, chromosome 7 at 18,818,715 bp
  • A to G, chromosome 7 at 30,078,276 bp
  • T to C, chromosome 7 at 44,016,267 bp
  • A to G, chromosome 7 at 44,016,913 bp
  • A to G, chromosome 7 at 45,866,128 bp
  • A to C, chromosome 7 at 80,254,163 bp
  • A to T, chromosome 7 at 92,660,060 bp
  • A to T, chromosome 7 at 102,781,658 bp
  • A to G, chromosome 7 at 104,049,755 bp
  • T to A, chromosome 8 at 15,915,357 bp
  • C to T, chromosome 8 at 22,938,775 bp
  • A to G, chromosome 8 at 47,674,539 bp
  • C to T, chromosome 8 at 83,610,764 bp
  • A to G, chromosome 8 at 85,074,938 bp
  • T to C, chromosome 8 at 91,270,123 bp
  • A to T, chromosome 8 at 105,953,920 bp
  • G to T, chromosome 9 at 7,102,405 bp
  • T to A, chromosome 9 at 60,713,286 bp
  • A to G, chromosome 9 at 92,343,673 bp
  • T to A, chromosome 10 at 52,123,381 bp
  • T to C, chromosome 11 at 58,551,401 bp
  • A to G, chromosome 11 at 59,428,722 bp
  • G to A, chromosome 11 at 69,890,471 bp
  • C to A, chromosome 11 at 70,350,714 bp
  • A to T, chromosome 11 at 72,456,860 bp
  • T to A, chromosome 11 at 74,121,733 bp
  • T to C, chromosome 11 at 118,513,274 bp
  • T to G, chromosome 12 at 17,550,057 bp
  • C to T, chromosome 12 at 38,857,046 bp
  • A to T, chromosome 12 at 113,330,446 bp
  • A to T, chromosome 13 at 27,582,103 bp
  • T to C, chromosome 13 at 98,755,216 bp
  • G to A, chromosome 14 at 20,714,368 bp
  • A to T, chromosome 14 at 57,430,536 bp
  • A to T, chromosome 14 at 59,647,842 bp
  • A to G, chromosome 14 at 68,571,754 bp
  • A to G, chromosome 14 at 122,876,774 bp
  • T to C, chromosome 15 at 6,643,699 bp
  • T to A, chromosome 15 at 11,023,350 bp
  • T to A, chromosome 15 at 79,036,863 bp
  • A to G, chromosome 16 at 29,586,996 bp
  • A to G, chromosome 16 at 37,826,726 bp
  • T to C, chromosome 17 at 24,599,630 bp
  • G to A, chromosome 18 at 12,419,845 bp
  • A to G, chromosome 18 at 37,520,632 bp
  • G to A, chromosome 19 at 5,971,571 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7243 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045307-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.