Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7268Btlr/Mmmh
Stock Number:
045319-MU
Citation ID:
RRID:MMRRC_045319-MU
Other Names:
R7268 (G1)
Major Collection:

Strain Information

Eri3
Name: exoribonuclease 3
Synonyms: PINT1, Prnpip1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140546
Homologene: 15403
Agap1
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Synonyms: Ggap1, Centg2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 347722
Homologene: 56689
Gdi2
Name: GDP dissociation inhibitor 2
Synonyms: GDI beta, GDI-B, GDIB, Gdi3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14569
VEGA: 13
HGNC: HGNC:4227
Homologene: 37488
Abl2
Name: ABL proto-oncogene 2, non-receptor tyrosine kinase
Synonyms: Arg, Abll
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11352
HGNC: HGNC:77
Homologene: 5278
Rps6ka2
Name: ribosomal protein S6 kinase, polypeptide 2
Synonyms: Rsk3, Rps6ka-rs1, 90kDa, p90rsk, pp90rsk, D17Wsu134e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20112
VEGA: 17
Homologene: 100680
Senp6
Name: SUMO/sentrin specific peptidase 6
Synonyms: E130319N12Rik, 2810017C20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215351
Homologene: 9196
Atp2a2
Name: ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Synonyms: sarco/endoplasmic reticulum Ca2+-ATPase 2, SERCA2, 9530097L16Rik, D5Wsu150e, SERCA2B, Serca2a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11938
HGNC: HGNC:812
Homologene: 80167
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 9,746,082 bp
  • A to G, chromosome 1 at 24,207,398 bp
  • G to T, chromosome 1 at 39,287,577 bp
  • T to G, chromosome 1 at 89,766,348 bp
  • C to A, chromosome 1 at 92,858,371 bp
  • C to T, chromosome 1 at 136,273,745 bp
  • T to C, chromosome 1 at 156,633,939 bp
  • T to C, chromosome 1 at 172,081,263 bp
  • T to A, chromosome 2 at 31,457,966 bp
  • G to T, chromosome 2 at 62,347,842 bp
  • C to A, chromosome 2 at 130,806,788 bp
  • G to A, chromosome 2 at 158,120,268 bp
  • A to G, chromosome 2 at 167,206,756 bp
  • A to G, chromosome 2 at 173,107,795 bp
  • C to T, chromosome 3 at 36,604,426 bp
  • CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC to CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC, chromosome 3 at 93,446,708 bp
  • A to G, chromosome 3 at 98,297,480 bp
  • A to C, chromosome 4 at 18,093,366 bp
  • T to A, chromosome 4 at 117,649,383 bp
  • A to G, chromosome 4 at 118,735,408 bp
  • A to T, chromosome 4 at 143,993,520 bp
  • G to A, chromosome 5 at 16,370,588 bp
  • T to C, chromosome 5 at 31,701,853 bp
  • T to C, chromosome 5 at 87,843,276 bp
  • T to A, chromosome 5 at 90,462,716 bp
  • T to A, chromosome 5 at 109,340,465 bp
  • T to A, chromosome 5 at 121,467,855 bp
  • T to C, chromosome 5 at 122,467,729 bp
  • T to C, chromosome 5 at 124,719,866 bp
  • G to C, chromosome 5 at 145,467,470 bp
  • A to G, chromosome 6 at 34,892,440 bp
  • A to T, chromosome 6 at 86,391,731 bp
  • A to T, chromosome 6 at 120,215,042 bp
  • G to T, chromosome 7 at 18,814,661 bp
  • T to G, chromosome 7 at 23,577,428 bp
  • G to A, chromosome 7 at 23,893,953 bp
  • G to A, chromosome 7 at 104,597,077 bp
  • A to T, chromosome 7 at 119,537,288 bp
  • A to G, chromosome 8 at 71,407,545 bp
  • A to G, chromosome 8 at 122,790,662 bp
  • T to A, chromosome 8 at 128,881,152 bp
  • A to G, chromosome 9 at 30,440,177 bp
  • G to A, chromosome 9 at 80,142,124 bp
  • G to T, chromosome 9 at 86,512,777 bp
  • G to A, chromosome 10 at 4,450,855 bp
  • T to A, chromosome 10 at 82,709,012 bp
  • A to G, chromosome 10 at 121,376,652 bp
  • A to G, chromosome 10 at 121,552,499 bp
  • A to G, chromosome 10 at 128,124,221 bp
  • C to T, chromosome 10 at 129,351,394 bp
  • A to T, chromosome 11 at 34,205,783 bp
  • T to A, chromosome 11 at 53,684,275 bp
  • C to T, chromosome 11 at 71,124,242 bp
  • A to T, chromosome 11 at 86,806,616 bp
  • A to G, chromosome 11 at 93,599,251 bp
  • A to G, chromosome 11 at 116,138,570 bp
  • T to A, chromosome 12 at 38,147,555 bp
  • C to A, chromosome 12 at 81,315,053 bp
  • A to T, chromosome 12 at 112,780,802 bp
  • T to A, chromosome 13 at 3,556,363 bp
  • G to A, chromosome 13 at 40,728,760 bp
  • A to G, chromosome 13 at 77,066,707 bp
  • T to C, chromosome 14 at 27,486,923 bp
  • A to G, chromosome 15 at 88,934,956 bp
  • G to A, chromosome 16 at 45,550,116 bp
  • A to C, chromosome 16 at 57,266,414 bp
  • T to C, chromosome 17 at 7,295,263 bp
  • T to C, chromosome 17 at 14,196,535 bp
  • A to T, chromosome 17 at 17,538,541 bp
  • T to C, chromosome 17 at 17,832,107 bp
  • A to T, chromosome 19 at 15,917,144 bp
  • C to T, chromosome 19 at 18,778,585 bp
  • G to T, chromosome 19 at 56,314,086 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7268 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045319-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.