Strain Name:
C57BL/6J-MtgxR7268Btlr/Mmmh
Stock Number:
045319-MU
Citation ID:
RRID:MMRRC_045319-MU
Other Names:
R7268 (G1)
Major Collection:

Strain Information

Eri3
Name: exoribonuclease 3
Synonyms: PINT1, Prnpip1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140546
Homologene: 15403
Agap1
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 1
Synonyms: Ggap1, Centg2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 347722
Homologene: 56689
Gdi2
Name: GDP dissociation inhibitor 2
Synonyms: GDI beta, GDI-B, GDIB, Gdi3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14569
VEGA: 13
HGNC: HGNC:4227
Homologene: 37488
Abl2
Name: ABL proto-oncogene 2, non-receptor tyrosine kinase
Synonyms: Arg, Abll
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11352
HGNC: HGNC:77
Homologene: 5278
Rps6ka2
Name: ribosomal protein S6 kinase, polypeptide 2
Synonyms: Rsk3, 90kDa, Rps6ka-rs1, p90rsk, pp90rsk, D17Wsu134e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20112
VEGA: 17
Homologene: 100680
Senp6
Name: SUMO/sentrin specific peptidase 6
Synonyms: E130319N12Rik, 2810017C20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215351
Homologene: 9196
Atp2a2
Name: ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Synonyms: sarco/endoplasmic reticulum Ca2+-ATPase 2, SERCA2, 9530097L16Rik, D5Wsu150e, SERCA2B, Serca2a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11938
HGNC: HGNC:812
Homologene: 80167
Baz2a
Name: bromodomain adjacent to zinc finger domain, 2A
Synonyms: Tip5, Walp3, C030005G16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 116848
VEGA: 10
HGNC: HGNC:962
Homologene: 8393
Psat1
Name: phosphoserine aminotransferase 1
Synonyms: PSA, D8Ertd814e, EPIP
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107272
Homologene: 6973
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: B130005I07Rik, D9Ertd809e, Dopey1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320615
Homologene: 26645
Camsap2
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: 1600013L13Rik, 4930541M15Rik, Camsap1l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67886
Homologene: 18927
Dhx40
Name: DEAH-box helicase 40
Synonyms: ARG147, DDX40, 2410016C14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67487
Homologene: 57000
Rad50
Name: RAD50 double strand break repair protein
Synonyms: Rad50l, Mrell
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19360
HGNC: HGNC:9816
Homologene: 38092
Slf1
Name: SMC5-SMC6 complex localization factor 1
Synonyms: C730024G01Rik, 2700017A04Rik, Brctx, Brctd1, Ankrd32
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105377
Homologene: 13000
Foxi1
Name: forkhead box I1
Synonyms: HFH-3, Fkh10, Hfh3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14233
HGNC: HGNC:3815
Homologene: 8140
Gpc1
Name: glypican 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14733
HGNC: HGNC:4449
Homologene: 20477
Mmp16
Name: matrix metallopeptidase 16
Synonyms: Membrane type 3-MMP, MT3-MMP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17389
HGNC: HGNC:7162
Homologene: 55939
Armt1
Name: acidic residue methyltransferase 1
Synonyms: 1700052N19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73419
Homologene: 41557
Tfap2a
Name: transcription factor AP-2, alpha
Synonyms: Ap-2 (a), AP-2 alpha, Ap2tf, Ap2, Tcfap2a, AP2alpha
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21418
VEGA: 13
Homologene: 2421
Alb
Name: albumin
Synonyms: Alb-1, Alb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11657
HGNC: HGNC:399
Homologene: 405
Babam2
Name: BRISC and BRCA1 A complex member 2
Synonyms: B830038C02Rik, 6030405P19Rik, Bre
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 107976
HGNC: HGNC:1106
Homologene: 3604
Ncstn
Name: nicastrin
Synonyms: nicastrin, 9430068N19Rik, Nct, D1Dau13e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 59287
Homologene: 41029
Tbk1
Name: TANK-binding kinase 1
Synonyms: 1200008B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56480
VEGA: 10
Homologene: 22742
Lnpep
Name: leucyl/cystinyl aminopeptidase
Synonyms: gp160, vp165, IRAP, 4732490P18Rik, 2010309L07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240028
VEGA: 17
HGNC: HGNC:6656
Homologene: 21148
Dact2
Name: dishevelled-binding antagonist of beta-catenin 2
Synonyms: dapper2, 2900084M21Rik, Frd2, Dpr2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240025
VEGA: 17
Homologene: 18237
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 665700
Homologene: 90772
Slc9c1
Name: solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms: LOC208169, spermNHE, Slc9a10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208169
Homologene: 19505
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225997
VEGA: 19
Homologene: 9767
Tmem116
Name: transmembrane protein 116
Synonyms: 4930513P12Rik, 4930406A18Rik, C030022K24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77462
Homologene: 12676
Bbs7
Name: Bardet-Biedl syndrome 7
Synonyms: 8430406N16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71492
Homologene: 12395
Spaca6
Name: sperm acrosome associated 6
Synonyms: B230206P06Rik, 4930546H06Rik, Ncrna00085
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75202
Homologene: 53443
Nlrp1a
Name: NLR family, pyrin domain containing 1A
Synonyms: Nalp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195046
Homologene: 133820
Ahnak2
Name: AHNAK nucleoprotein 2
Synonyms: LOC382643
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100041194
Homologene: 131081
Dnaaf9
Name: dynein axonemal assembly factor 9
Synonyms: 4930402H24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228602
Homologene: 12623
Slc8a3
Name: solute carrier family 8 (sodium/calcium exchanger), member 3
Synonyms: Ncx3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110893
Homologene: 62645
Dgkb
Name: diacylglycerol kinase, beta
Synonyms: DGK-beta, C630029D13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217480
VEGA: 12
HGNC: HGNC:2850
Homologene: 37875
Col9a1
Name: collagen, type IX, alpha 1
Synonyms: Col9a-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12839
HGNC: HGNC:2217
Homologene: 1393
Car10
Name: carbonic anhydrase 10
Synonyms: CA-RP X, 2700029L05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72605
HGNC: HGNC:1369
Homologene: 23201
Wdr91
Name: WD repeat domain 91
Synonyms: 9530020G05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101240
Homologene: 8562
Gns
Name: glucosamine (N-acetyl)-6-sulfatase
Synonyms: G6S, 2610016K11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75612
VEGA: 10
HGNC: HGNC:4422
Homologene: 1568
Vmn1r178
Name: vomeronasal 1 receptor 178
Synonyms: LOC232959, V1rd13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232959
Homologene: 104166
B4galnt3
Name: beta-1,4-N-acetyl-galactosaminyl transferase 3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330406
Homologene: 18328
Snx19
Name: sorting nexin 19
Synonyms: 3526401K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102607
VEGA: 9
Homologene: 8846
Atp6v0a2
Name: ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms: TJ6s, Tj6, ATP6a2, Atp6n2, 8430408C20Rik, V-ATPase a2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21871
Homologene: 56523
Ctcfl
Name: CCCTC-binding factor like
Synonyms: Boris, OTTMUSG00000016680
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 664799
Homologene: 46476
Cacna2d1
Name: calcium channel, voltage-dependent, alpha2/delta subunit 1
Synonyms: Cchl2a, Cacna2, Ca(v)alpha2delta1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12293
HGNC: HGNC:1399
Homologene: 579
Acsf3
Name: acyl-CoA synthetase family member 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 257633
Homologene: 14958
Vcpip1
Name: valosin containing protein (p97)/p47 complex interacting protein 1
Synonyms: 5730421J18Rik, 5730538E15Rik, Vcip135
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70675
Homologene: 11814
Pramel14
Name: PRAME like 14
Synonyms: Gm13107, Pramef17
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 626943
Homologene: 129642
Vmn2r16
Name: vomeronasal 2, receptor 16
Synonyms: EG384220
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384220
Homologene: 104825
Ptgis
Name: prostaglandin I2 (prostacyclin) synthase
Synonyms: Pgi2, Pgis, Cyp8a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19223
HGNC: HGNC:9603
Homologene: 37374
Tchh
Name: trichohyalin
Synonyms: Thh, AHF
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99681
Homologene: 136273
Ankle1
Name: ankyrin repeat and LEM domain containing 1
Synonyms: 8430438L13Rik, Ankrd41
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234396
Homologene: 17562
Cyp3a16
Name: cytochrome P450, family 3, subfamily a, polypeptide 16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13114
HGNC: HGNC:2638
Homologene: 133568
Ccdc66
Name: coiled-coil domain containing 66
Synonyms: E230015L20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 320234
VEGA: 14
Homologene: 35309
Hcfc2
Name: host cell factor C2
Synonyms: 1700129L13Rik, fkls
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67933
Homologene: 8337
Habp2
Name: hyaluronic acid binding protein 2
Synonyms: FSAP
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226243
HGNC: HGNC:4798
Homologene: 3050
Or52ac1
Name: olfactory receptor family 52 subfamily AC member 1
Synonyms: GA_x6K02T2PBJ9-7224628-7223702, MOR38-1, Olfr655
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258817
Homologene: 17403
Or13p5
Name: olfactory receptor family 13 subfamily P member 5
Synonyms: GA_x6K02T2QD9B-18815145-18814198, MOR258-2, Olfr1339
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258851
Homologene: 27280
Or6c6
Name: olfactory receptor family 6 subfamily C member 6
Synonyms: GA_x6K02T2PULF-11031172-11032116, MOR110-8, Olfr782
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 257985
Homologene: 133581
Ccdc7a
Name: coiled-coil domain containing 7A
Synonyms: 4930540C21Rik, 4930517G15Rik, Ccdc7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74703
Homologene: 134760
Dpp4
Name: dipeptidylpeptidase 4
Synonyms: THAM, Dpp-4, Cd26
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13482
HGNC: HGNC:3009
Homologene: 3279
Acsm5
Name: acyl-CoA synthetase medium-chain family member 5
Synonyms: C730027J19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 272428
Homologene: 69242
Mrpl38
Name: mitochondrial ribosomal protein L38
Synonyms: MRP-L3, Rpml3, 4733401F03Rik, 1110036N21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 60441
Homologene: 11476
Prr27
Name: proline rich 27
Synonyms: 4930432K09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73779
Homologene: 136277
Hmgcs2
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
Synonyms: mHS
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15360
HGNC: HGNC:5008
Homologene: 38066
Tgm2
Name: transglutaminase 2, C polypeptide
Synonyms: tissue transglutaminase, protein-glutamine gamma-glutamyltransferase, G[a]h, TG C, tTGas, tTG, TG2, TGase2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21817
Homologene: 3391
Tmem30c
Name: transmembrane protein 30C
Synonyms: 4933409A18Rik, 4933401B01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71027
Homologene: 78138
Pcyox1
Name: prenylcysteine oxidase 1
Synonyms: 1200015P13Rik, PCL1, Pcly
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66881
Homologene: 9458
Ttll8
Name: tubulin tyrosine ligase-like family, member 8
Synonyms: 1700019P01Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239591
Homologene: 52766
Psg17
Name: pregnancy specific beta-1-glycoprotein 17
Synonyms: mmCGM5, Cea-2, Cea2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26437
HGNC: HGNC:1819
Homologene: 110989
Npas2
Name: neuronal PAS domain protein 2
Synonyms: MOP4, bHLHe9
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18143
HGNC: HGNC:7895
Homologene: 1887
Vmn1r169
Name: vomeronasal 1 receptor 169
Synonyms: Gm4232
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043103
Homologene: 128341
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 9,746,082 bp
  • A to G, chromosome 1 at 24,207,398 bp
  • G to T, chromosome 1 at 39,287,577 bp
  • T to G, chromosome 1 at 89,766,348 bp
  • C to A, chromosome 1 at 92,858,371 bp
  • C to T, chromosome 1 at 136,273,745 bp
  • T to C, chromosome 1 at 156,633,939 bp
  • T to C, chromosome 1 at 172,081,263 bp
  • T to A, chromosome 2 at 31,457,966 bp
  • G to T, chromosome 2 at 62,347,842 bp
  • C to A, chromosome 2 at 130,806,788 bp
  • G to A, chromosome 2 at 158,120,268 bp
  • A to G, chromosome 2 at 167,206,756 bp
  • A to G, chromosome 2 at 173,107,795 bp
  • C to T, chromosome 3 at 36,604,426 bp
  • CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC to CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC, chromosome 3 at 93,446,708 bp
  • A to G, chromosome 3 at 98,297,480 bp
  • A to C, chromosome 4 at 18,093,366 bp
  • T to A, chromosome 4 at 117,649,383 bp
  • A to G, chromosome 4 at 118,735,408 bp
  • A to T, chromosome 4 at 143,993,520 bp
  • G to A, chromosome 5 at 16,370,588 bp
  • T to C, chromosome 5 at 31,701,853 bp
  • T to C, chromosome 5 at 87,843,276 bp
  • T to A, chromosome 5 at 90,462,716 bp
  • T to A, chromosome 5 at 109,340,465 bp
  • T to A, chromosome 5 at 121,467,855 bp
  • T to C, chromosome 5 at 122,467,729 bp
  • T to C, chromosome 5 at 124,719,866 bp
  • G to C, chromosome 5 at 145,467,470 bp
  • A to G, chromosome 6 at 34,892,440 bp
  • A to T, chromosome 6 at 86,391,731 bp
  • A to T, chromosome 6 at 120,215,042 bp
  • G to T, chromosome 7 at 18,814,661 bp
  • T to G, chromosome 7 at 23,577,428 bp
  • G to A, chromosome 7 at 23,893,953 bp
  • G to A, chromosome 7 at 104,597,077 bp
  • A to T, chromosome 7 at 119,537,288 bp
  • A to G, chromosome 8 at 71,407,545 bp
  • A to G, chromosome 8 at 122,790,662 bp
  • T to A, chromosome 8 at 128,881,152 bp
  • A to G, chromosome 9 at 30,440,177 bp
  • G to A, chromosome 9 at 80,142,124 bp
  • G to T, chromosome 9 at 86,512,777 bp
  • G to A, chromosome 10 at 4,450,855 bp
  • T to A, chromosome 10 at 82,709,012 bp
  • A to G, chromosome 10 at 121,376,652 bp
  • A to G, chromosome 10 at 121,552,499 bp
  • A to G, chromosome 10 at 128,124,221 bp
  • C to T, chromosome 10 at 129,351,394 bp
  • A to T, chromosome 11 at 34,205,783 bp
  • T to A, chromosome 11 at 53,684,275 bp
  • C to T, chromosome 11 at 71,124,242 bp
  • A to T, chromosome 11 at 86,806,616 bp
  • A to G, chromosome 11 at 93,599,251 bp
  • A to G, chromosome 11 at 116,138,570 bp
  • T to A, chromosome 12 at 38,147,555 bp
  • C to A, chromosome 12 at 81,315,053 bp
  • A to T, chromosome 12 at 112,780,802 bp
  • T to A, chromosome 13 at 3,556,363 bp
  • G to A, chromosome 13 at 40,728,760 bp
  • A to G, chromosome 13 at 77,066,707 bp
  • T to C, chromosome 14 at 27,486,923 bp
  • A to G, chromosome 15 at 88,934,956 bp
  • G to A, chromosome 16 at 45,550,116 bp
  • A to C, chromosome 16 at 57,266,414 bp
  • T to C, chromosome 17 at 7,295,263 bp
  • T to C, chromosome 17 at 14,196,535 bp
  • A to T, chromosome 17 at 17,538,541 bp
  • T to C, chromosome 17 at 17,832,107 bp
  • A to T, chromosome 19 at 15,917,144 bp
  • C to T, chromosome 19 at 18,778,585 bp
  • G to T, chromosome 19 at 56,314,086 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7268 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045319-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.