Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7308Btlr/Mmmh
Stock Number:
045323-MU
Citation ID:
RRID:MMRRC_045323-MU
Other Names:
R7308 (G1)
Major Collection:

Strain Information

Hmox1
Name: heme oxygenase 1
Synonyms: Hsp32, HO-1, heme oxygenase 1, D8Wsu38e, Hmox, HO1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15368
HGNC: HGNC:5013
Homologene: 31075
Bcar3
Name: breast cancer anti-estrogen resistance 3
Synonyms: AND-34
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 29815
HGNC: HGNC:973
Homologene: 31181
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Taok3
Name: TAO kinase 3
Synonyms: A430105I05Rik, 2900006A08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330177
Homologene: 83279
Hspa4
Name: heat shock protein 4
Synonyms: APG-2, Hsp70RY, Hsp110, 70kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15525
HGNC: HGNC:5237
Homologene: 1624
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 36,659,407 bp
  • G to A, chromosome 1 at 72,651,794 bp
  • T to A, chromosome 1 at 75,557,362 bp
  • G to T, chromosome 1 at 128,319,087 bp
  • A to G, chromosome 1 at 139,754,303 bp
  • A to T, chromosome 1 at 181,906,385 bp
  • T to A, chromosome 2 at 5,973,518 bp
  • T to C, chromosome 2 at 25,900,463 bp
  • T to C, chromosome 2 at 60,334,515 bp
  • A to T, chromosome 2 at 69,749,462 bp
  • G to A, chromosome 2 at 114,104,062 bp
  • C to T, chromosome 3 at 28,902,280 bp
  • A to T, chromosome 3 at 29,151,866 bp
  • C to T, chromosome 3 at 53,478,704 bp
  • A to C, chromosome 3 at 56,091,031 bp
  • A to T, chromosome 3 at 89,998,566 bp
  • A to G, chromosome 3 at 93,074,565 bp
  • T to C, chromosome 3 at 95,562,555 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • TCACTGGTTCTGTGGTCACTGGTTCTGTGG to TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG, chromosome 3 at 95,888,152 bp
  • ACTGGTTCTGTGGTC to ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC, chromosome 3 at 95,888,169 bp
  • A to T, chromosome 3 at 100,620,105 bp
  • T to C, chromosome 3 at 116,594,739 bp
  • T to A, chromosome 3 at 122,508,493 bp
  • A to G, chromosome 4 at 115,327,758 bp
  • T to A, chromosome 5 at 117,200,151 bp
  • A to T, chromosome 5 at 125,787,646 bp
  • T to C, chromosome 6 at 48,406,339 bp
  • T to C, chromosome 6 at 91,778,688 bp
  • T to A, chromosome 6 at 136,565,089 bp
  • A to T, chromosome 7 at 11,307,153 bp
  • T to C, chromosome 7 at 116,373,839 bp
  • T to C, chromosome 7 at 120,423,770 bp
  • T to G, chromosome 8 at 11,406,856 bp
  • A to G, chromosome 8 at 19,126,379 bp
  • A to T, chromosome 8 at 25,640,724 bp
  • T to C, chromosome 8 at 41,082,928 bp
  • T to A, chromosome 8 at 75,097,019 bp
  • A to T, chromosome 9 at 52,068,870 bp
  • T to C, chromosome 9 at 53,798,010 bp
  • A to G, chromosome 9 at 114,473,863 bp
  • G to A, chromosome 10 at 80,026,558 bp
  • G to A, chromosome 10 at 80,323,173 bp
  • G to A, chromosome 11 at 49,469,927 bp
  • A to G, chromosome 11 at 53,267,103 bp
  • A to G, chromosome 11 at 75,167,151 bp
  • T to C, chromosome 11 at 95,004,571 bp
  • T to A, chromosome 12 at 17,174,729 bp
  • A to G, chromosome 12 at 110,665,162 bp
  • A to G, chromosome 12 at 117,995,275 bp
  • A to T, chromosome 13 at 67,669,553 bp
  • G to A, chromosome 13 at 77,051,168 bp
  • C to T, chromosome 14 at 23,330,935 bp
  • A to G, chromosome 14 at 43,543,707 bp
  • G to A, chromosome 14 at 50,425,265 bp
  • T to A, chromosome 14 at 53,806,979 bp
  • G to A, chromosome 14 at 67,694,991 bp
  • C to T, chromosome 15 at 57,952,816 bp
  • T to C, chromosome 15 at 58,152,610 bp
  • T to G, chromosome 16 at 35,456,509 bp
  • C to T, chromosome 16 at 46,071,734 bp
  • T to C, chromosome 18 at 3,122,875 bp
  • T to C, chromosome 18 at 65,449,609 bp
  • A to G, chromosome 19 at 4,751,574 bp
  • C to T, chromosome 19 at 5,686,147 bp
  • A to T, chromosome 19 at 37,910,911 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7308 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045323-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.