Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7308Btlr/Mmmh
Stock Number:
045323-MU
Citation ID:
RRID:MMRRC_045323-MU
Other Names:
R7308 (G1)
Major Collection:

Strain Information

Hmox1
Name: heme oxygenase 1
Synonyms: Hsp32, HO-1, heme oxygenase 1, D8Wsu38e, Hmox, HO1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15368
HGNC: HGNC:5013
Homologene: 31075
Bcar3
Name: breast cancer anti-estrogen resistance 3
Synonyms: AND-34
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 29815
HGNC: HGNC:973
Homologene: 31181
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Taok3
Name: TAO kinase 3
Synonyms: A430105I05Rik, 2900006A08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330177
Homologene: 83279
Hspa4
Name: heat shock protein 4
Synonyms: APG-2, Hsp70RY, Hsp110, 70kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15525
HGNC: HGNC:5237
Homologene: 1624
Cdca2
Name: cell division cycle associated 2
Synonyms: 2610311M19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 108912
Homologene: 18444
Trmt13
Name: tRNA methyltransferase 13
Synonyms: A930028L21Rik, 4631408H19Rik, Ccdc76
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229780
Homologene: 6875
Proser1
Name: proline and serine rich 1
Synonyms: 2810046L04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 212127
Homologene: 13463
Atf7ip
Name: activating transcription factor 7 interacting protein
Synonyms: ATFa-associated Modulator, AM, 2610204M12Rik, Mcaf1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54343
Homologene: 10051
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Slf1
Name: SMC5-SMC6 complex localization factor 1
Synonyms: C730024G01Rik, 2700017A04Rik, Brctx, Brctd1, Ankrd32
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105377
Homologene: 13000
Malt1
Name: MALT1 paracaspase
Synonyms: D430033E09Rik, paracaspase, Pcasp1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240354
HGNC: HGNC:6819
Homologene: 4938
Upf2
Name: UPF2 regulator of nonsense transcripts homolog (yeast)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 326622
Homologene: 6101
Zfp738
Name: zinc finger protein 738
Synonyms: 6720487G11Rik, 3830402I07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408068
Homologene: 133713
Glb1
Name: galactosidase, beta 1
Synonyms: Bgs, Bge, Bgt, Bgl, Bgl-t, Bgl-s, Bgl-e, C130097A14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12091
VEGA: 9
HGNC: HGNC:4298
Homologene: 47922
Sptbn2
Name: spectrin beta, non-erythrocytic 2
Synonyms: Spnb3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20743
VEGA: 19
Homologene: 48482
Pcnx3
Name: pecanex homolog 3
Synonyms: Pcnxl3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104401
Homologene: 17000
Pdia5
Name: protein disulfide isomerase associated 5
Synonyms: 2700053F16Rik, Pdir
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72599
VEGA: 16
Homologene: 4957
Mtus1
Name: mitochondrial tumor suppressor 1
Synonyms: MD44, MTSG1, Atip1, B430305I03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102103
Homologene: 100292
Abca16
Name: ATP-binding cassette, sub-family A member 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233810
Homologene: 132942
Lct
Name: lactase
Synonyms: LOC226413, Lphl, LPH
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226413
HGNC: HGNC:6530
Homologene: 124204
Man1a2
Name: mannosidase, alpha, class 1A, member 2
Synonyms: Man1b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17156
HGNC: HGNC:6822
Homologene: 55982
Myof
Name: myoferlin
Synonyms: 2310051D19Rik, E030042N20Rik, Fer1l3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226101
VEGA: 19
HGNC: HGNC:3656
Homologene: 40882
Hormad1
Name: HORMA domain containing 1
Synonyms: 4921522K05Rik, Nohma
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67981
Homologene: 69415
Egfem1
Name: EGF-like and EMI domain containing 1
Synonyms: 6130401L20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75740
Homologene: 135950
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b1279Clo, b2b1203Clo, b2b598Clo, b2b1289Clo, b2b1727Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Slc4a3
Name: solute carrier family 4 (anion exchanger), member 3
Synonyms: Ae3, A930038D23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20536
Homologene: 129474
Ly75
Name: lymphocyte antigen 75
Synonyms: DEC-205, CD205
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17076
Homologene: 31085
Ankar
Name: ankyrin and armadillo repeat containing
Synonyms: 4932422E22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319695
Homologene: 85163
Ppp1r9b
Name: protein phosphatase 1, regulatory subunit 9B
Synonyms: neurabin II, spinophilin, Spn, SPL
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217124
HGNC: HGNC:9298
Homologene: 32787
Kcnt1
Name: potassium channel, subfamily T, member 1
Synonyms: slo2, Slack, C030030G16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227632
Homologene: 11055
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: Slo, mSlo1, Slo1, MaxiK, BK channel alpha subunit, 5730414M22Rik, BKCa
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
Krba1
Name: KRAB-A domain containing 1
Synonyms: A930040G15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 77827
Homologene: 15880
Col4a2
Name: collagen, type IV, alpha 2
Synonyms: Col4a-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12827
HGNC: HGNC:2203
Homologene: 1390
Cyp4a12a
Name: cytochrome P450, family 4, subfamily a, polypeptide 12a
Synonyms: Cyp4a12
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277753
Homologene: 134044
Cd96
Name: CD96 antigen
Synonyms: Tactile, 1700109I12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 84544
Homologene: 68489
Cfhr4
Name: complement factor H-related 4
Synonyms: Gm4788
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214403
HGNC: HGNC:4883
Nsd3
Name: nuclear receptor binding SET domain protein 3
Synonyms: WHISTLE, Whsc1l1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234135
Homologene: 56960
Hic1
Name: hypermethylated in cancer 1
Synonyms: HIC-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15248
HGNC: HGNC:4909
Homologene: 4740
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Tbc1d31
Name: TBC1 domain family, member 31
Synonyms: LOC210544, D330013L20Rik, Wdr67
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 210544
Homologene: 17089
Grip2
Name: glutamate receptor interacting protein 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243547
Homologene: 16327
Zscan4e
Name: zinc finger and SCAN domain containing 4E
Synonyms: EG665848
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665848
Homologene: 85986
Gm1527
Name: predicted gene 1527
Synonyms: LOC385263
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 385263
Homologene: 133976
Ppig
Name: peptidyl-prolyl isomerase G (cyclophilin G)
Synonyms: SRCyp, B230312B02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228005
Homologene: 3520
Fam178b
Name: family with sequence similarity 178, member B
Synonyms: LOC381337, 1700024G10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381337
Homologene: 87288
Slc35f2
Name: solute carrier family 35, member F2
Synonyms: 1500009K05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72022
VEGA: 9
Homologene: 36363
Or11g24
Name: olfactory receptor family 11 subfamily G member 24
Synonyms: GA_x6K02T2PMLR-6121675-6122604, MOR106-2, Olfr739
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258663
Homologene: 121549
Tmem132b
Name: transmembrane protein 132B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208151
Homologene: 28135
Arhgap45
Name: Rho GTPase activating protein 45
Synonyms: 6330406L22Rik, Hmha1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70719
Homologene: 69120
Pcsk4
Name: proprotein convertase subtilisin/kexin type 4
Synonyms: PC4, SPC5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18551
HGNC: HGNC:8746
Homologene: 22495
Or2y1c
Name: olfactory receptor family 2 subfamily Y member 1C
Synonyms: GA_x6K02T2QP88-5964781-5963852, MOR256-50, Olfr1386
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 257888
Homologene: 86692
Hax1
Name: HCLS1 associated X-1
Synonyms: mHAX-1s, HAX-1, Silg111, Hs1bp1, HS1-associated protein X-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23897
Homologene: 4463
Kcnf1
Name: potassium voltage-gated channel, subfamily F, member 1
Synonyms: LOC382571
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 382571
HGNC: HGNC:6246
Homologene: 124236
Vmn1r238
Name: vomeronasal 1 receptor, 238
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100312476
Homologene: 128342
Ntaq1
Name: N-terminal glutamine amidase 1
Synonyms: 2410187C16Rik, Wdyhv1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76773
VEGA: 15
Homologene: 9968
Tdpoz8
Name: TD and POZ domain containing 8
Synonyms: Gm4858
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229571
Homologene: 130121
Trav17
Name: T cell receptor alpha variable 17
Synonyms: OTTMUSG00000015028
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 627777
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 36,659,407 bp
  • G to A, chromosome 1 at 72,651,794 bp
  • T to A, chromosome 1 at 75,557,362 bp
  • G to T, chromosome 1 at 128,319,087 bp
  • A to G, chromosome 1 at 139,754,303 bp
  • A to T, chromosome 1 at 181,906,385 bp
  • T to A, chromosome 2 at 5,973,518 bp
  • T to C, chromosome 2 at 25,900,463 bp
  • T to C, chromosome 2 at 60,334,515 bp
  • A to T, chromosome 2 at 69,749,462 bp
  • G to A, chromosome 2 at 114,104,062 bp
  • C to T, chromosome 3 at 28,902,280 bp
  • A to T, chromosome 3 at 29,151,866 bp
  • C to T, chromosome 3 at 53,478,704 bp
  • A to C, chromosome 3 at 56,091,031 bp
  • A to T, chromosome 3 at 89,998,566 bp
  • A to G, chromosome 3 at 93,074,565 bp
  • T to C, chromosome 3 at 95,562,555 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • TCACTGGTTCTGTGGTCACTGGTTCTGTGG to TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG, chromosome 3 at 95,888,152 bp
  • ACTGGTTCTGTGGTC to ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC, chromosome 3 at 95,888,169 bp
  • A to T, chromosome 3 at 100,620,105 bp
  • T to C, chromosome 3 at 116,594,739 bp
  • T to A, chromosome 3 at 122,508,493 bp
  • A to G, chromosome 4 at 115,327,758 bp
  • T to A, chromosome 5 at 117,200,151 bp
  • A to T, chromosome 5 at 125,787,646 bp
  • T to C, chromosome 6 at 48,406,339 bp
  • T to C, chromosome 6 at 91,778,688 bp
  • T to A, chromosome 6 at 136,565,089 bp
  • A to T, chromosome 7 at 11,307,153 bp
  • T to C, chromosome 7 at 116,373,839 bp
  • T to C, chromosome 7 at 120,423,770 bp
  • T to G, chromosome 8 at 11,406,856 bp
  • A to G, chromosome 8 at 19,126,379 bp
  • A to T, chromosome 8 at 25,640,724 bp
  • T to C, chromosome 8 at 41,082,928 bp
  • T to A, chromosome 8 at 75,097,019 bp
  • A to T, chromosome 9 at 52,068,870 bp
  • T to C, chromosome 9 at 53,798,010 bp
  • A to G, chromosome 9 at 114,473,863 bp
  • G to A, chromosome 10 at 80,026,558 bp
  • G to A, chromosome 10 at 80,323,173 bp
  • G to A, chromosome 11 at 49,469,927 bp
  • A to G, chromosome 11 at 53,267,103 bp
  • A to G, chromosome 11 at 75,167,151 bp
  • T to C, chromosome 11 at 95,004,571 bp
  • T to A, chromosome 12 at 17,174,729 bp
  • A to G, chromosome 12 at 110,665,162 bp
  • A to G, chromosome 12 at 117,995,275 bp
  • A to T, chromosome 13 at 67,669,553 bp
  • G to A, chromosome 13 at 77,051,168 bp
  • C to T, chromosome 14 at 23,330,935 bp
  • A to G, chromosome 14 at 43,543,707 bp
  • G to A, chromosome 14 at 50,425,265 bp
  • T to A, chromosome 14 at 53,806,979 bp
  • G to A, chromosome 14 at 67,694,991 bp
  • C to T, chromosome 15 at 57,952,816 bp
  • T to C, chromosome 15 at 58,152,610 bp
  • T to G, chromosome 16 at 35,456,509 bp
  • C to T, chromosome 16 at 46,071,734 bp
  • T to C, chromosome 18 at 3,122,875 bp
  • T to C, chromosome 18 at 65,449,609 bp
  • A to G, chromosome 19 at 4,751,574 bp
  • C to T, chromosome 19 at 5,686,147 bp
  • A to T, chromosome 19 at 37,910,911 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7308 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045323-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.