Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7317Btlr/Mmmh
Stock Number:
045369-MU
Citation ID:
RRID:MMRRC_045369-MU
Other Names:
R7317 (G1)
Major Collection:

Strain Information

Uso1
Name: USO1 vesicle docking factor
Synonyms: transcytosis associated protein p115, TAP, Vdp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56041
Homologene: 2754
Htr5b
Name: 5-hydroxytryptamine (serotonin) receptor 5B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15564
Homologene: 74951
Mbd5
Name: methyl-CpG binding domain protein 5
Synonyms: 9430004D19Rik, C030040A15Rik, OTTMUSG00000012483
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109241
Homologene: 81861
Tert
Name: telomerase reverse transcriptase
Synonyms: TR
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21752
VEGA: 13
Homologene: 31141
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Fubp3
Name: far upstream element (FUSE) binding protein 3
Synonyms: FBP3, A330051M14Rik, Marta2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320267
HGNC: HGNC:4005
Homologene: 45954
Pdzd2
Name: PDZ domain containing 2
Synonyms: 4930537L06Rik, LOC223364, A930022H17Rik, Pdzk3, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 16,460,329 bp
  • A to T, chromosome 1 at 40,474,832 bp
  • A to G, chromosome 1 at 40,525,376 bp
  • T to A, chromosome 1 at 121,510,428 bp
  • A to G, chromosome 2 at 31,604,612 bp
  • A to G, chromosome 2 at 49,279,743 bp
  • G to T, chromosome 2 at 83,794,983 bp
  • A to T, chromosome 2 at 90,282,404 bp
  • G to A, chromosome 2 at 130,048,291 bp
  • G to A, chromosome 2 at 163,502,447 bp
  • T to A, chromosome 2 at 181,995,820 bp
  • T to C, chromosome 3 at 38,483,183 bp
  • G to T, chromosome 3 at 54,749,331 bp
  • T to C, chromosome 3 at 58,636,884 bp
  • T to A, chromosome 3 at 141,789,942 bp
  • A to G, chromosome 4 at 63,972,722 bp
  • T to C, chromosome 4 at 111,939,520 bp
  • T to A, chromosome 4 at 156,239,216 bp
  • A to T, chromosome 5 at 3,618,875 bp
  • G to A, chromosome 5 at 8,090,202 bp
  • G to A, chromosome 5 at 62,649,724 bp
  • A to G, chromosome 5 at 92,173,992 bp
  • A to T, chromosome 5 at 121,853,273 bp
  • G to A, chromosome 6 at 4,691,615 bp
  • A to G, chromosome 6 at 124,826,318 bp
  • G to A, chromosome 6 at 145,158,698 bp
  • A to G, chromosome 7 at 3,669,919 bp
  • A to G, chromosome 7 at 34,263,647 bp
  • C to T, chromosome 7 at 66,840,556 bp
  • A to C, chromosome 7 at 80,254,163 bp
  • T to C, chromosome 7 at 81,461,028 bp
  • G to T, chromosome 7 at 108,255,218 bp
  • ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC to ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC, chromosome 7 at 142,165,420 bp
  • G to T, chromosome 8 at 63,113,556 bp
  • A to G, chromosome 9 at 7,446,937 bp
  • T to A, chromosome 9 at 14,575,219 bp
  • A to T, chromosome 9 at 45,943,690 bp
  • G to C, chromosome 9 at 85,324,617 bp
  • T to A, chromosome 10 at 88,762,935 bp
  • A to G, chromosome 10 at 123,013,946 bp
  • T to C, chromosome 11 at 16,994,739 bp
  • A to T, chromosome 11 at 72,245,127 bp
  • A to G, chromosome 11 at 74,665,704 bp
  • T to C, chromosome 11 at 84,877,240 bp
  • T to G, chromosome 11 at 87,085,565 bp
  • T to C, chromosome 12 at 24,655,519 bp
  • A to T, chromosome 12 at 103,333,357 bp
  • A to G, chromosome 13 at 23,622,367 bp
  • T to C, chromosome 13 at 49,378,308 bp
  • G to A, chromosome 13 at 73,642,376 bp
  • A to G, chromosome 13 at 92,286,004 bp
  • T to A, chromosome 14 at 20,400,434 bp
  • A to T, chromosome 14 at 53,763,494 bp
  • A to T, chromosome 14 at 54,360,855 bp
  • G to A, chromosome 14 at 122,978,181 bp
  • T to C, chromosome 15 at 12,592,243 bp
  • T to A, chromosome 15 at 78,525,006 bp
  • T to C, chromosome 16 at 4,991,735 bp
  • T to C, chromosome 16 at 11,222,657 bp
  • T to C, chromosome 16 at 13,122,113 bp
  • A to G, chromosome 16 at 17,405,632 bp
  • G to T, chromosome 16 at 17,671,643 bp
  • T to G, chromosome 16 at 59,149,321 bp
  • T to C, chromosome 16 at 88,829,305 bp
  • A to G, chromosome 17 at 13,116,284 bp
  • A to T, chromosome 17 at 15,742,274 bp
  • T to A, chromosome 17 at 18,243,620 bp
  • C to T, chromosome 17 at 24,901,718 bp
  • C to T, chromosome 17 at 37,069,413 bp
  • A to T, chromosome 18 at 37,413,026 bp
  • T to C, chromosome 19 at 5,720,702 bp
  • T to A, chromosome 19 at 6,314,504 bp
  • C to T, chromosome 19 at 42,583,540 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7317 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045369-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.