Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7293Btlr/Mmmh
Stock Number:
045398-MU
Citation ID:
RRID:MMRRC_045398-MU
Other Names:
R7293 (G1)
Major Collection:

Strain Information

Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Csrnp3
Name: cysteine-serine-rich nuclear protein 3
Synonyms: mbu1, A330102K23Rik, CSRNP-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77771
Homologene: 11803
Prkd2
Name: protein kinase D2
Synonyms: PKD2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101540
Homologene: 9516
Taf3
Name: TATA-box binding protein associated factor 3
Synonyms: mTAFII140, 4933439M23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209361
Homologene: 35415
Copb1
Name: coatomer protein complex, subunit beta 1
Synonyms: Copb1, 2610019B04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70349
HGNC: HGNC:2231
Homologene: 5664
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 58,414,613 bp
  • T to C, chromosome 1 at 82,523,943 bp
  • A to G, chromosome 1 at 105,808,141 bp
  • T to A, chromosome 1 at 164,295,883 bp
  • G to T, chromosome 2 at 9,952,090 bp
  • G to A, chromosome 2 at 21,576,939 bp
  • A to G, chromosome 2 at 65,949,000 bp
  • A to C, chromosome 2 at 87,492,362 bp
  • A to T, chromosome 2 at 90,021,527 bp
  • A to G, chromosome 2 at 111,483,354 bp
  • T to A, chromosome 2 at 112,902,603 bp
  • T to C, chromosome 2 at 126,035,752 bp
  • A to C, chromosome 2 at 132,089,106 bp
  • T to C, chromosome 2 at 180,642,165 bp
  • C to A, chromosome 3 at 28,087,286 bp
  • C to T, chromosome 3 at 40,985,444 bp
  • A to T, chromosome 3 at 92,868,819 bp
  • T to C, chromosome 3 at 104,840,835 bp
  • C to T, chromosome 3 at 145,486,304 bp
  • T to A, chromosome 4 at 94,638,390 bp
  • T to C, chromosome 4 at 107,080,946 bp
  • T to C, chromosome 4 at 108,631,676 bp
  • C to T, chromosome 4 at 141,043,556 bp
  • C to T, chromosome 4 at 141,755,935 bp
  • T to C, chromosome 4 at 155,856,168 bp
  • G to A, chromosome 5 at 37,127,473 bp
  • A to G, chromosome 5 at 140,419,428 bp
  • A to G, chromosome 6 at 83,763,196 bp
  • C to G, chromosome 6 at 132,571,758 bp
  • T to C, chromosome 7 at 16,845,940 bp
  • G to A, chromosome 7 at 26,571,269 bp
  • A to G, chromosome 7 at 99,336,533 bp
  • T to A, chromosome 7 at 104,670,718 bp
  • A to T, chromosome 7 at 105,434,645 bp
  • A to T, chromosome 7 at 114,219,602 bp
  • C to A, chromosome 7 at 118,166,099 bp
  • A to G, chromosome 8 at 3,538,068 bp
  • A to G, chromosome 8 at 22,065,379 bp
  • A to T, chromosome 8 at 70,115,211 bp
  • T to C, chromosome 8 at 71,325,905 bp
  • T to C, chromosome 8 at 91,034,079 bp
  • A to T, chromosome 8 at 111,168,743 bp
  • A to G, chromosome 9 at 7,001,454 bp
  • G to C, chromosome 9 at 15,915,040 bp
  • A to C, chromosome 9 at 15,915,296 bp
  • G to T, chromosome 9 at 37,537,724 bp
  • A to T, chromosome 9 at 39,364,834 bp
  • T to C, chromosome 9 at 87,203,783 bp
  • T to G, chromosome 9 at 121,255,124 bp
  • T to C, chromosome 10 at 44,003,432 bp
  • T to C, chromosome 10 at 45,419,186 bp
  • G to A, chromosome 10 at 107,635,506 bp
  • A to G, chromosome 11 at 5,064,338 bp
  • C to T, chromosome 11 at 99,483,856 bp
  • A to G, chromosome 12 at 70,460,551 bp
  • A to T, chromosome 12 at 115,158,821 bp
  • T to A, chromosome 13 at 13,680,237 bp
  • T to C, chromosome 13 at 22,501,702 bp
  • C to T, chromosome 13 at 23,034,669 bp
  • T to C, chromosome 13 at 49,264,658 bp
  • T to A, chromosome 13 at 93,092,797 bp
  • A to T, chromosome 14 at 31,287,863 bp
  • G to T, chromosome 14 at 51,655,882 bp
  • G to T, chromosome 14 at 52,314,411 bp
  • A to G, chromosome 14 at 54,947,174 bp
  • CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATATTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC to CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC, chromosome 14 at 56,647,846 bp
  • A to G, chromosome 14 at 66,035,185 bp
  • A to T, chromosome 15 at 27,871,289 bp
  • G to A, chromosome 15 at 36,523,450 bp
  • A to G, chromosome 15 at 102,447,393 bp
  • G to A, chromosome 16 at 4,932,220 bp
  • G to A, chromosome 16 at 85,899,945 bp
  • A to C, chromosome 16 at 96,426,796 bp
  • C to T, chromosome 17 at 30,924,625 bp
  • G to A, chromosome 19 at 43,807,053 bp
  • G to T, chromosome 19 at 55,291,210 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7293 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045398-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.