Strain Name:
C57BL/6J-MtgxR7293Btlr/Mmmh
Stock Number:
045398-MU
Citation ID:
RRID:MMRRC_045398-MU
Other Names:
R7293 (G1)
Major Collection:

Strain Information

Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Csrnp3
Name: cysteine-serine-rich nuclear protein 3
Synonyms: mbu1, A330102K23Rik, CSRNP-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77771
Homologene: 11803
Prkd2
Name: protein kinase D2
Synonyms: PKD2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101540
Homologene: 9516
Taf3
Name: TATA-box binding protein associated factor 3
Synonyms: 4933439M23Rik, mTAFII140
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209361
Homologene: 35415
Copb1
Name: coatomer protein complex, subunit beta 1
Synonyms: Copb1, 2610019B04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70349
HGNC: HGNC:2231
Homologene: 5664
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: 5430435M13Rik, C130002K18Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans), 2610207I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Cc2d1b
Name: coiled-coil and C2 domain containing 1B
Synonyms: A830039B04Rik, Freud2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 319965
Homologene: 70951
Myo9b
Name: myosin IXb
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17925
HGNC: HGNC:7609
Homologene: 3058
Mgrn1
Name: mahogunin, ring finger 1
Synonyms: nc, 2610042J20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17237
VEGA: 16
Homologene: 41020
Amhr2
Name: anti-Mullerian hormone type 2 receptor
Synonyms: MIS TypeII receptor, MISIIR
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110542
HGNC: HGNC:465
Homologene: 10746
Parp4
Name: poly (ADP-ribose) polymerase family, member 4
Synonyms: VPARP, VAULT3, p193, PH5P, E230037B21Rik, Adprtl1, C030027K23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328417
HGNC: HGNC:271
Homologene: 124423
Eif3b
Name: eukaryotic translation initiation factor 3, subunit B
Synonyms: EIF3-P116, D5Wsu45e, Eif3s9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27979
HGNC: HGNC:3280
Homologene: 2780
Tmx1
Name: thioredoxin-related transmembrane protein 1
Synonyms: Txndc1, 2810425A04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72736
Homologene: 12482
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: Solo, 6720464I07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Gas2l1
Name: growth arrest-specific 2 like 1
Synonyms: TU-71.1, D0Jmb1, GAR22, 4930500E24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78926
Homologene: 4733
Cckbr
Name: cholecystokinin B receptor
Synonyms: CCK-B/gastrin receptor, CCK2/gastrin, CCK2R, CCKR-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12426
HGNC: HGNC:1571
Homologene: 7258
Acsl5
Name: acyl-CoA synthetase long-chain family member 5
Synonyms: 1700030F05Rik, Facl5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433256
VEGA: 19
Homologene: 69208
Esam
Name: endothelial cell-specific adhesion molecule
Synonyms: W117m, 2310008D05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69524
Homologene: 12316
Glg1
Name: golgi apparatus protein 1
Synonyms: ESL-1, CFR, MG-160, MG160, CFR-1, Selel
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20340
HGNC: HGNC:4316
Homologene: 7533
Clk1
Name: CDC-like kinase 1
Synonyms: STY, Clk1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12747
HGNC: HGNC:2068
Homologene: 101535
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Pnpla6
Name: patatin-like phospholipase domain containing 6
Synonyms: Swiss-cheese, MSws, Nte
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50767
Homologene: 21333
Col4a4
Name: collagen, type IV, alpha 4
Synonyms: [a]4(IV), E130010M05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12829
HGNC: HGNC:2206
Homologene: 20071
Blzf1
Name: basic leucine zipper nuclear factor 1
Synonyms: Blzf1l, Jem-1, 1700030G05Rik, Golgin-45
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66352
HGNC: HGNC:1065
Homologene: 31187
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, E030034C22Rik, B230373P09Rik, Dnahc1, G1-415-19, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Fgd3
Name: FYVE, RhoGEF and PH domain containing 3
Synonyms: ZFYVE5, 5830461L01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 30938
Homologene: 22925
Fgf7
Name: fibroblast growth factor 7
Synonyms: Kgf, Keratinocyte growth factor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14178
HGNC: HGNC:3685
Homologene: 7316
Col24a1
Name: collagen, type XXIV, alpha 1
Synonyms: 5430404K19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71355
Homologene: 65061
Myh6
Name: myosin, heavy polypeptide 6, cardiac muscle, alpha
Synonyms: alpha myosin, Myhc-a, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, A830009F23Rik, alpha-MHC, alphaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17888
HGNC: HGNC:7576
Homologene: 124414
Pld1
Name: phospholipase D1
Synonyms: Pld1b, Pld1a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18805
HGNC: HGNC:9067
Homologene: 116234
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Ptprq
Name: protein tyrosine phosphatase receptor type Q
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, 9430076A06Rik, D430038H04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Nlrp9a
Name: NLR family, pyrin domain containing 9A
Synonyms: D7Ertd565e, Nalp9a, Nalp-theta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233001
Homologene: 116072
Itgb2l
Name: integrin beta 2-like
Synonyms: pactolus, 5033406G21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16415
HGNC: HGNC:6155
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Ulk4
Name: unc-51-like kinase 4
Synonyms: 4932415A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209012
Homologene: 41205
Map6
Name: microtubule-associated protein 6
Synonyms: F-STOP, STOP, 2810411E12Rik, Mtap6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17760
HGNC: HGNC:6868
Homologene: 7850
Jakmip1
Name: janus kinase and microtubule interacting protein 1
Synonyms: Marlin-1, 5830437M04Rik, C330021K24Rik, Gababrbp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76071
Homologene: 90789
Cep162
Name: centrosomal protein 162
Synonyms: 4922501C03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382090
Homologene: 8930
Crybg1
Name: crystallin beta-gamma domain containing 1
Synonyms: Aim1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11630
HGNC: HGNC:356
Homologene: 18168
Gpr158
Name: G protein-coupled receptor 158
Synonyms: 5330427M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241263
Homologene: 19381
Lrrc19
Name: leucine rich repeat containing 19
Synonyms: 9130022A01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100061
Homologene: 36410
Adam2
Name: a disintegrin and metallopeptidase domain 2
Synonyms: Ph30-beta, Ftnb, fertilin beta
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11495
VEGA: 14
HGNC: HGNC:198
Homologene: 1127
Vmn1r214
Name: vomeronasal 1 receptor 214
Synonyms: V1rh5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171248
Homologene: 110880
Glp1r
Name: glucagon-like peptide 1 receptor
Synonyms: GLP-1R, GLP1Rc
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14652
VEGA: 17
HGNC: HGNC:4324
Homologene: 1558
Crocc
Name: ciliary rootlet coiled-coil, rootletin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230872
Homologene: 16811
Abcc2
Name: ATP-binding cassette, sub-family member 2
Synonyms: multidrug resistance protein 2, Mrp2, Cmoat
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12780
HGNC: HGNC:53
Homologene: 68052
Ncan
Name: neurocan
Synonyms: Tgfbit, Cspg3, Cspg3-rs
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13004
HGNC: HGNC:2465
Homologene: 3229
Alg11
Name: ALG11 alpha-1,2-mannosyltransferase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 207958
Homologene: 68893
Krt23
Name: keratin 23
Synonyms: K23, CK23, Krt1-23
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94179
HGNC: HGNC:6438
Homologene: 9172
Tnfrsf11a
Name: tumor necrosis factor receptor superfamily, member 11a, NFKB activator
Synonyms: TRANCE-R, Rank
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21934
Homologene: 2848
Slc23a2
Name: solute carrier family 23 (nucleobase transporters), member 2
Synonyms: SVCT2, YSPL3, Slc23a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54338
Homologene: 68440
Larp1b
Name: La ribonucleoprotein 1B
Synonyms: 1700108L22Rik, 4933421B21Rik, Larp2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214048
Homologene: 103869
Adamts5
Name: ADAM metallopeptidase with thrombospondin type 1 motif 5
Synonyms: ADAM-TS5, 9530092O11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 23794
VEGA: 16
HGNC: HGNC:221
Homologene: 5109
Ankrd53
Name: ankyrin repeat domain 53
Synonyms: 4930564N15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75305
Homologene: 49810
Kplce
Name: KPRP N-terminal and LCE C-terminal like protein
Synonyms: 2310050C09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66533
Homologene: 104374
Dvl1
Name: dishevelled segment polarity protein 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13542
Homologene: 20926
Prh1
Name: proline rich protein HaeIII subfamily 1
Synonyms: A-type, MP2, Prp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19131
Vmn1r202
Name: vomeronasal 1 receptor 202
Synonyms: V1ri7
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171258
Homologene: 110880
Pramel7
Name: PRAME like 7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 347712
Homologene: 87261
Snx31
Name: sorting nexin 31
Synonyms: 4631426E05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66696
Homologene: 23551
Lin28b
Name: lin-28 homolog B
Synonyms: D030047M17Rik, 2810403D23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380669
VEGA: 10
Homologene: 47607
Sall2
Name: spalt like transcription factor 2
Synonyms: Msal-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50524
Homologene: 9269
Or52n20
Name: olfactory receptor family 52 subfamily N member 20
Synonyms: GA_x6K02T2PBJ9-7298889-7299857, MOR34-4, Olfr659
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259052
Homologene: 74118
Or4f4b
Name: olfactory receptor family 4 subfamily F member 4B
Synonyms: GA_x6K02T2Q125-72534883-72535821, MOR245-6, Olfr1289
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258399
Tcfl5
Name: transcription factor-like 5 (basic helix-loop-helix)
Synonyms: Figlb, FIG beta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277353
Homologene: 4814
Cyb5rl
Name: cytochrome b5 reductase-like
Synonyms: 2810410C14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230582
Homologene: 45506
Gm5622
Name: predicted gene 5622
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 434459
Homologene: 115686
Capza1
Name: capping actin protein of muscle Z-line subunit alpha 1
Synonyms: Cappa1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12340
HGNC: HGNC:1488
Homologene: 24376
Or4c3
Name: olfactory receptor family 4 subfamily C member 3
Synonyms: GA_x6K02T2Q125-51454183-51453257, MOR236-1, Olfr1264
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258206
Homologene: 66365
Agmat
Name: agmatinase
Synonyms: 5033405N08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75986
Homologene: 99855
Or8g31-ps1
Name: olfactory receptor family 8 subfamily G member 31, pseudogene 1
Synonyms: GA_x6K02T2PVTD-33061144-33062101, MOR171-26P, Olfr949-ps1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258194
VEGA: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 58,414,613 bp
  • T to C, chromosome 1 at 82,523,943 bp
  • A to G, chromosome 1 at 105,808,141 bp
  • T to A, chromosome 1 at 164,295,883 bp
  • G to T, chromosome 2 at 9,952,090 bp
  • G to A, chromosome 2 at 21,576,939 bp
  • A to G, chromosome 2 at 65,949,000 bp
  • A to C, chromosome 2 at 87,492,362 bp
  • A to T, chromosome 2 at 90,021,527 bp
  • A to G, chromosome 2 at 111,483,354 bp
  • T to A, chromosome 2 at 112,902,603 bp
  • T to C, chromosome 2 at 126,035,752 bp
  • A to C, chromosome 2 at 132,089,106 bp
  • T to C, chromosome 2 at 180,642,165 bp
  • C to A, chromosome 3 at 28,087,286 bp
  • C to T, chromosome 3 at 40,985,444 bp
  • A to T, chromosome 3 at 92,868,819 bp
  • T to C, chromosome 3 at 104,840,835 bp
  • C to T, chromosome 3 at 145,486,304 bp
  • T to A, chromosome 4 at 94,638,390 bp
  • T to C, chromosome 4 at 107,080,946 bp
  • T to C, chromosome 4 at 108,631,676 bp
  • C to T, chromosome 4 at 141,043,556 bp
  • C to T, chromosome 4 at 141,755,935 bp
  • T to C, chromosome 4 at 155,856,168 bp
  • G to A, chromosome 5 at 37,127,473 bp
  • A to G, chromosome 5 at 140,419,428 bp
  • A to G, chromosome 6 at 83,763,196 bp
  • C to G, chromosome 6 at 132,571,758 bp
  • T to C, chromosome 7 at 16,845,940 bp
  • G to A, chromosome 7 at 26,571,269 bp
  • A to G, chromosome 7 at 99,336,533 bp
  • T to A, chromosome 7 at 104,670,718 bp
  • A to T, chromosome 7 at 105,434,645 bp
  • A to T, chromosome 7 at 114,219,602 bp
  • C to A, chromosome 7 at 118,166,099 bp
  • A to G, chromosome 8 at 3,538,068 bp
  • A to G, chromosome 8 at 22,065,379 bp
  • A to T, chromosome 8 at 70,115,211 bp
  • T to C, chromosome 8 at 71,325,905 bp
  • T to C, chromosome 8 at 91,034,079 bp
  • A to T, chromosome 8 at 111,168,743 bp
  • A to G, chromosome 9 at 7,001,454 bp
  • G to C, chromosome 9 at 15,915,040 bp
  • A to C, chromosome 9 at 15,915,296 bp
  • G to T, chromosome 9 at 37,537,724 bp
  • A to T, chromosome 9 at 39,364,834 bp
  • T to C, chromosome 9 at 87,203,783 bp
  • T to G, chromosome 9 at 121,255,124 bp
  • T to C, chromosome 10 at 44,003,432 bp
  • T to C, chromosome 10 at 45,419,186 bp
  • G to A, chromosome 10 at 107,635,506 bp
  • A to G, chromosome 11 at 5,064,338 bp
  • C to T, chromosome 11 at 99,483,856 bp
  • A to G, chromosome 12 at 70,460,551 bp
  • A to T, chromosome 12 at 115,158,821 bp
  • T to A, chromosome 13 at 13,680,237 bp
  • T to C, chromosome 13 at 22,501,702 bp
  • C to T, chromosome 13 at 23,034,669 bp
  • T to C, chromosome 13 at 49,264,658 bp
  • T to A, chromosome 13 at 93,092,797 bp
  • A to T, chromosome 14 at 31,287,863 bp
  • G to T, chromosome 14 at 51,655,882 bp
  • G to T, chromosome 14 at 52,314,411 bp
  • A to G, chromosome 14 at 54,947,174 bp
  • CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATATTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC to CTTCCTCCCCCTCCCCTTCTCTCTGCTGGCACCCATCTTCCTCCCCCTCCCCTTCTCCCTGCTGGCACCCATATTCCTCCCCCTCCCC, chromosome 14 at 56,647,846 bp
  • A to G, chromosome 14 at 66,035,185 bp
  • A to T, chromosome 15 at 27,871,289 bp
  • G to A, chromosome 15 at 36,523,450 bp
  • A to G, chromosome 15 at 102,447,393 bp
  • G to A, chromosome 16 at 4,932,220 bp
  • G to A, chromosome 16 at 85,899,945 bp
  • A to C, chromosome 16 at 96,426,796 bp
  • C to T, chromosome 17 at 30,924,625 bp
  • G to A, chromosome 19 at 43,807,053 bp
  • G to T, chromosome 19 at 55,291,210 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7293 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045398-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.